ID: 1102157657

View in Genome Browser
Species Human (GRCh38)
Location 12:110743470-110743492
Sequence CATTGTGAGTGGTGGGTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102157653_1102157657 12 Left 1102157653 12:110743435-110743457 CCTCTTTCAGATAAGTCAAAATG 0: 1
1: 0
2: 2
3: 41
4: 794
Right 1102157657 12:110743470-110743492 CATTGTGAGTGGTGGGTATATGG 0: 1
1: 0
2: 3
3: 35
4: 162
1102157652_1102157657 13 Left 1102157652 12:110743434-110743456 CCCTCTTTCAGATAAGTCAAAAT 0: 1
1: 0
2: 0
3: 34
4: 386
Right 1102157657 12:110743470-110743492 CATTGTGAGTGGTGGGTATATGG 0: 1
1: 0
2: 3
3: 35
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102157657 Original CRISPR CATTGTGAGTGGTGGGTATA TGG Intergenic
900016251 1:152263-152285 CCTTGTGATTGGTGGGTATGGGG + Intergenic
900046515 1:510854-510876 CCTTGTGATTGGTGGGTATGGGG + Intergenic
900068718 1:752571-752593 CCTTGTGATTGGTGGGTATGGGG + Intergenic
901813256 1:11779596-11779618 GATGATGAGTGGTGGGGATAGGG - Intronic
902269160 1:15290630-15290652 CAGTGTGGGTGGTAGGTATGTGG - Intronic
904287718 1:29462727-29462749 CCTTGTGAGTAGTGGGTAGGAGG + Intergenic
905587139 1:39129327-39129349 CCTTGTGAGAGGTGGGGATATGG + Intronic
907464346 1:54624915-54624937 CATTGTGAGTGGTGAGTCTGGGG + Intronic
908003121 1:59701110-59701132 CACTGGGAGTGCTGGGGATAGGG + Intronic
910748673 1:90602795-90602817 CAGGTTGAGTGGTGGGCATATGG + Intergenic
913614540 1:120545150-120545172 CATTGAGAGAGGTGGGAATCAGG - Intergenic
914575731 1:148965751-148965773 CATTGAGAGAGGTGGGAATCAGG + Intronic
916452361 1:164933306-164933328 CATTGTAAATGGTGGATGTAGGG + Intergenic
916479870 1:165205354-165205376 CTTTGGGTGGGGTGGGTATAAGG + Intronic
916991308 1:170248733-170248755 CATTTTGGGTGGTGGGTGTGGGG - Intergenic
917623178 1:176818901-176818923 AATTGGGAGTGGTGGGGAGATGG - Intronic
918294979 1:183148012-183148034 CATTGGGAATGGTGGGTCTGAGG - Intergenic
918389678 1:184045858-184045880 CAAGGTGGGTGCTGGGTATATGG - Intergenic
919158414 1:193797838-193797860 CACAGTGAGTGGTGGGTATATGG + Intergenic
920121426 1:203661610-203661632 CATTGAGGGTGGTGGGCATAGGG - Intronic
920337821 1:205257013-205257035 CACTGTGAGTTGTGTGCATAAGG - Intronic
922104075 1:222497956-222497978 CCTTGTGATTGGTGGGTATGGGG + Intergenic
922264395 1:223970477-223970499 CCTTGTGATTGGTGGGTATGGGG + Intergenic
922273752 1:224057670-224057692 CATTGTGTATGGTGGGTGTGAGG + Intergenic
924346245 1:243075471-243075493 CCTTGTGATTGGTGGGTATGGGG + Intergenic
1064110695 10:12536167-12536189 CAGTCTGGGTGGTGGGTACATGG - Intronic
1065038441 10:21664723-21664745 TATTGTGAGCGGTGGGTATTAGG + Intronic
1065975936 10:30842437-30842459 CATTGAGAATGGTGGGAAGAGGG - Intronic
1066730100 10:38429355-38429377 CCTTGTGATTGGTGGGTATGGGG - Intergenic
1067750780 10:48969744-48969766 CATTGTAAGTGATGGGATTAGGG - Intronic
1069899475 10:71699042-71699064 CATGGGGAGTGGTCGGTAAATGG + Intronic
1071903117 10:90141964-90141986 CTTTGTGAGTGATGGCTTTATGG + Intergenic
1073351849 10:102825536-102825558 CATTGTGTGGGCTGGGTATAGGG - Intergenic
1075707729 10:124511850-124511872 CCTGGTGAGTGGTGGGGAGATGG + Intronic
1076972843 11:147332-147354 CCTTGTGATTGGTGGGTATGGGG + Intergenic
1077899936 11:6479999-6480021 CATTGTGTCTGGTGGCTATGGGG - Exonic
1078221914 11:9358503-9358525 GATTCTGGGTGGTGGGAATATGG - Intergenic
1079822830 11:25152179-25152201 TATTGGGAGTGGAGGGTATCAGG + Intergenic
1083694100 11:64431064-64431086 CTGGGTGAGTGATGGGTATATGG - Intergenic
1084924189 11:72498807-72498829 CATGGAGAGTGAGGGGTATATGG - Intergenic
1086223923 11:84484356-84484378 CACAGTGAGTGGTGAGTATCTGG - Intronic
1086600469 11:88627283-88627305 ATTTGTGAGTGGTGGGTTTATGG - Intronic
1093042500 12:14399895-14399917 GATTGTGAGTGGTGGGGAAGTGG + Intronic
1096965162 12:55620439-55620461 CCTTCTGGGTGGTGGGGATATGG + Intergenic
1102157657 12:110743470-110743492 CATTGTGAGTGGTGGGTATATGG + Intergenic
1103401219 12:120644265-120644287 CATAGTGAGTGCTGGATAAAGGG + Intronic
1104073166 12:125364359-125364381 GAATCTAAGTGGTGGGTATATGG - Intronic
1104908208 12:132226746-132226768 CAGTGTGTGGGGTGGGTGTATGG - Intronic
1105793915 13:23831881-23831903 CATTTTCAATGCTGGGTATAGGG + Intronic
1105806366 13:23953741-23953763 CATTGCCAGTGGTGGGGAGATGG - Intergenic
1109986672 13:69995178-69995200 CCTTGGGAGTGTGGGGTATATGG - Intronic
1113934928 13:113988950-113988972 CAGGGTGAGTGATGGGTGTACGG - Intronic
1114638157 14:24200500-24200522 GATTTTGTGTGGTGGGTATTAGG - Intronic
1118648171 14:67860745-67860767 GAGTCTAAGTGGTGGGTATATGG + Intronic
1120153503 14:81064708-81064730 GATTGGGAGTTCTGGGTATATGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1124825250 15:33087745-33087767 CATTGTGATTGATGGGGATTTGG - Intronic
1124962345 15:34408488-34408510 CAGTGTGTGTGGTGTGTATGTGG - Intronic
1124978969 15:34554710-34554732 CAGTGTGTGTGGTGTGTATGTGG - Intronic
1132078865 15:98847513-98847535 CATTCTAGGTGGTGGGTACAAGG - Intronic
1136497900 16:30655056-30655078 CACTGTGGGTGGTGGGGAAATGG + Exonic
1137691073 16:50428229-50428251 CAATGTTAGAGGTGGGTGTAGGG + Intergenic
1140726828 16:77821097-77821119 CATAGTGAGTGATGGGTTGATGG - Intronic
1142447408 16:90150195-90150217 CCTTGTGATTGGTGGGTATGGGG - Intergenic
1142460085 17:85137-85159 CCTTGTGATTGGTGGGTATGGGG + Intergenic
1143406794 17:6683036-6683058 CTTTGTGAATGATGGGTCTAAGG + Intergenic
1143517252 17:7426081-7426103 CATTGTCAGGGGTGGGGATGGGG - Intronic
1143846440 17:9775791-9775813 CATTCTGAGTACTGGGTATTGGG - Intronic
1146696389 17:34911751-34911773 CATTGTGATGGGTGGGAATGGGG + Intergenic
1148088669 17:45009622-45009644 CATGGTGAGGGGTGGGCAGAGGG - Intergenic
1148091148 17:45023180-45023202 CTTTGTGGGAGGTGGGTAGAGGG - Intergenic
1151712077 17:75812708-75812730 CCTTTTGAATGGTGGGTGTAGGG - Intronic
1153135146 18:1909166-1909188 CATTCTGAGTGCTGGGGATTAGG + Intergenic
1154333659 18:13449680-13449702 CATTGTTAGTGGAGGGTGTTGGG + Intronic
1157577494 18:48753429-48753451 CATTTTGGGAGGTGGGTGTAGGG - Intronic
1157625370 18:49046116-49046138 CTATGTGAGTGGTGTGTATTTGG - Intronic
1158343940 18:56495641-56495663 GATTCTGGGTGGTGGGTACAGGG + Intergenic
1160649800 19:217637-217659 CCTTGTGATTGGTGGGTATGGGG + Intergenic
1161500848 19:4614640-4614662 CATCCTGAGTGGTGGGAAGAAGG - Intergenic
1162726216 19:12691048-12691070 CACTCTGAGTGGTGAGTATTTGG + Intronic
1163091912 19:15026213-15026235 CAGTGTGCGTGGTGGCTTTATGG + Intergenic
1164767453 19:30782573-30782595 CAGTGTCAATGGTGGGTATGGGG - Intergenic
1166814850 19:45537858-45537880 AATTCTAAGTGGTGGGTACAAGG + Intronic
926501349 2:13656955-13656977 CAATGTGAGTAGTGGTTAAATGG - Intergenic
935036411 2:99379526-99379548 AATTCTGAATGGTGAGTATATGG - Intronic
937275043 2:120678940-120678962 CACTGAGAGGGGAGGGTATAAGG - Intergenic
939249544 2:139666675-139666697 TATTGTGGGGGCTGGGTATAGGG + Intergenic
939816205 2:146900341-146900363 CATGGAGTGTGGTGTGTATATGG + Intergenic
939897673 2:147811134-147811156 CCTTTTGAGTGGTGGGAATGTGG - Intergenic
942537943 2:176985196-176985218 AATAGTGAGTGGTGGGGAGAGGG - Intergenic
946537143 2:220643391-220643413 CATGGTGGGTGGTGGGTATGAGG + Intergenic
1169641523 20:7757562-7757584 CTATGTGAGAGGTGGGTAGAAGG - Intergenic
1170703919 20:18728037-18728059 CATTGTGAGTGTGTGGGATAGGG + Intronic
1170843614 20:19943804-19943826 CATGCTGGGTGGTGGGTAAAAGG + Intronic
1171234255 20:23511388-23511410 CATAGTGGGTGGTGGGTGTGAGG - Intergenic
1171326455 20:24297823-24297845 CATTGTGAGGGGTGGGAATGAGG + Intergenic
1173502542 20:43564729-43564751 CAGTGTGTGTGGTGTGCATATGG - Intronic
1178523961 21:33309417-33309439 AATTGTGAGTGTTGGTCATAAGG - Intergenic
1178779813 21:35591318-35591340 CATTTTAAGTGGTAGGAATATGG - Intronic
1179047623 21:37860619-37860641 CAGTGTGAGTGATGGGGAGAAGG - Intronic
1179708886 21:43200145-43200167 AAATTTGAGTGGCGGGTATATGG - Intergenic
1181713992 22:24711045-24711067 CATTTTGAGTTATGGTTATATGG - Intergenic
1183049539 22:35249678-35249700 CACTCTGGGTGGTGGGTACATGG + Intergenic
1183977673 22:41522801-41522823 CATTGTGGGTGGTGGGGTTAAGG - Intronic
949480376 3:4488631-4488653 CCTTGTGAGTGGAGGGAACATGG - Intergenic
950864991 3:16181803-16181825 CAGTGTGAGTGGTGCTTATGGGG + Intronic
951521141 3:23611753-23611775 CATGGTGAGTGCTGAGTAAACGG + Intergenic
953824956 3:46243609-46243631 AAGTGAGAGTGGTGGGAATAAGG + Intronic
955393608 3:58538633-58538655 CATTGTTAGTGCTGGGTGTTAGG - Intergenic
958055281 3:88402914-88402936 AAATCTGAGTGGTGGGTACAAGG + Intergenic
958784022 3:98577165-98577187 AGTGGTGAGTGGTGAGTATATGG + Intronic
959533081 3:107455823-107455845 CATTGTGAGAGGAGGGTGTGAGG + Intergenic
960898465 3:122530457-122530479 CATTTCTAGTGGTGGGAATAGGG - Intronic
961169490 3:124786541-124786563 CTTTGGGAGTGGTGGCTATGGGG + Intronic
964606785 3:158568999-158569021 CTCTGTGAGTGCTGGTTATATGG - Intergenic
967424986 3:189316658-189316680 CAGTGTGCGTGGTGGGGACAGGG - Intronic
968368049 3:198202492-198202514 CCTTGTGATTGGTGGGTATGGGG - Intergenic
970493888 4:16606027-16606049 CACTGAGATTGGTGGGTATAGGG - Intronic
972953876 4:44365159-44365181 CAGGGAGAGTGGTGGGCATATGG + Intronic
975723968 4:77274380-77274402 CATTGTGAGCCATGGGTATACGG + Intronic
976486602 4:85612667-85612689 AAATGTGAGTGGTGGGTATATGG - Intronic
976673719 4:87681814-87681836 CATTTTTGGTGTTGGGTATAAGG - Intergenic
977523394 4:98113893-98113915 CATTGGGTTTGGTGGGTGTAGGG + Intronic
977673474 4:99722354-99722376 CAGTGTGGGTGTTGGTTATAAGG + Intergenic
979130574 4:117039516-117039538 CATTGTGAGGAGTGGTTATAAGG - Intergenic
979256478 4:118612213-118612235 CCTTGTGATTGGTGGGTATGGGG - Intergenic
979331874 4:119428324-119428346 CCTTGTGATTGGTGGGTATGAGG + Intergenic
979549722 4:121977297-121977319 CATTGTGAGTGGTGGGGATGAGG + Intergenic
982038336 4:151369656-151369678 AATTCTGAGTGATGGGTATGTGG - Intergenic
983270507 4:165556213-165556235 CAGACTGAGTGGTGGGCATATGG - Intergenic
986093057 5:4529797-4529819 CATTGTGAGTCTGTGGTATAAGG + Intergenic
986206682 5:5631014-5631036 CATTGTGTGTTGTGAGTATGTGG + Intergenic
988347580 5:30058185-30058207 GAAACTGAGTGGTGGGTATATGG - Intergenic
989324479 5:40175180-40175202 CATTGTTAGAGTTGGCTATATGG - Intergenic
991110083 5:62889831-62889853 CATTGTGAGTGCTAAGTAAATGG - Intergenic
992156403 5:73959191-73959213 CATTTTGATTGGGAGGTATAGGG + Intergenic
994173479 5:96684047-96684069 CATTCTGAGTGTAGGGTTTAGGG + Intronic
994588322 5:101740199-101740221 CATTTTGTGTGCTGGATATAAGG - Intergenic
994760390 5:103844498-103844520 CAGTGTGAGGGGTGGCTATAAGG + Intergenic
998064997 5:139150881-139150903 CACTGTGAGTGGTGGGGCTGTGG - Intronic
1000125942 5:158244092-158244114 CATTTTGGCTGGTGGGTGTAGGG + Intergenic
1002727268 5:181307721-181307743 CCTTGTGATTGGTGGGTATGGGG - Intergenic
1002952150 6:1824519-1824541 CATTGTGAGAGGTGGGCATTTGG - Intronic
1002953859 6:1842726-1842748 TATTTTGAGGGGTGGGGATAGGG + Intronic
1007180492 6:39926056-39926078 GATTGTGTGTGTTGGGCATAGGG - Intronic
1007735037 6:43976848-43976870 TATTCTGGGTGGTGGGTTTAAGG - Intergenic
1007803767 6:44421101-44421123 GAATCTAAGTGGTGGGTATATGG - Intronic
1008653600 6:53588547-53588569 GTTTGTGATTGGTGGGTATATGG + Intronic
1008706524 6:54167117-54167139 TATTGTGAGTCAGGGGTATAGGG - Intronic
1010025890 6:71216159-71216181 TAATATGGGTGGTGGGTATATGG + Intergenic
1011259535 6:85456768-85456790 CATTCTGTCTGGTAGGTATAGGG + Intronic
1012352717 6:98272610-98272632 CATGGTGTGTGGTAGGAATATGG - Intergenic
1013318505 6:108963988-108964010 CTCTGGGAGTGGTGGGTATTGGG + Intronic
1015502045 6:133944898-133944920 CACTGTGATTGGTGGGAAGAAGG - Intergenic
1017918672 6:158853228-158853250 CATAGTGTGTGGTGTGTGTATGG - Intergenic
1017934702 6:158995145-158995167 AATTGAGAGTTTTGGGTATATGG - Intronic
1021757170 7:23863170-23863192 GAATGTAAGTGATGGGTATATGG - Intergenic
1022259499 7:28690637-28690659 CATTGCGAGGGGTGGAGATAAGG + Intronic
1023055663 7:36287879-36287901 CAATGTGAGTCGCGGGTACAGGG + Intronic
1023398460 7:39773493-39773515 CCTTGTGATTGGTGGGCATGGGG - Intergenic
1023885369 7:44350071-44350093 CATTGTGAGGGGTGGGGAGAAGG - Intergenic
1023885631 7:44352389-44352411 CATTGTGAGGGGTGGTGAGAAGG + Intergenic
1025134195 7:56396997-56397019 CCTTGTGATTGGTGGGCATGGGG + Intergenic
1031061353 7:117054917-117054939 CATTGTGTGTGGTGGTAATGTGG + Intronic
1032048787 7:128632961-128632983 CCTTGTGATTGGTGGGTATGGGG - Intergenic
1033466758 7:141598252-141598274 CATTATGACTGGTGCGTTTATGG - Intronic
1036657249 8:10684649-10684671 ATTTGTGAGTAGTGGATATAGGG - Intronic
1038536287 8:28354941-28354963 CATTGTGAGTGGTTCCTATAGGG - Intronic
1040609501 8:48968618-48968640 TAGTGTGTGTGGTGTGTATATGG + Intergenic
1041016909 8:53600235-53600257 CATAGTGAGTGGAGGCTATGTGG - Intergenic
1041565653 8:59275376-59275398 CATTGTGAGTGGTCGGAAGCAGG - Intergenic
1046604408 8:116354822-116354844 CTTTTTAAGTCGTGGGTATATGG + Intergenic
1050435869 9:5610305-5610327 AATTGTGAGTTGTGGGTTTTGGG - Intergenic
1051151482 9:14084579-14084601 CACTGTGAGTGGTGGGTGGCAGG + Intronic
1053181612 9:35976361-35976383 CATTGGTGGTGGTGGGTATCAGG + Intergenic
1053453901 9:38215881-38215903 AAATGTTAATGGTGGGTATATGG + Intergenic
1055782680 9:79836307-79836329 CATCATGAGTGGTGTGTATAGGG + Intergenic
1057478496 9:95425908-95425930 GAAAGTAAGTGGTGGGTATATGG + Intergenic
1057934468 9:99225303-99225325 GATAGAGAGTGGTGGGGATAGGG + Intronic
1059670389 9:116485585-116485607 CATGGTGAGTGGTGGGACTGGGG - Intronic
1059738138 9:117122739-117122761 CATTGCTGGTGGTGGGTTTATGG + Intronic
1061396231 9:130345155-130345177 TATTGTGTGTGGTGTGTGTATGG + Intronic
1062664735 9:137663365-137663387 TGTTGTGAGTGGTGGGTTAATGG + Intronic
1062752390 9:138265197-138265219 CCTTGTGATTGGTGGGTATGGGG - Intergenic
1187989604 X:24855161-24855183 CATCTTGAGTGGTAGGGATATGG + Intronic
1188033890 X:25295539-25295561 CTTTGTAAATGATGGGTATATGG - Intergenic
1188087489 X:25918540-25918562 AAATATAAGTGGTGGGTATATGG + Intergenic
1189662564 X:43317672-43317694 GATTGACAGTGGTGGATATAAGG - Intergenic
1189739087 X:44100364-44100386 CATTGTGCATGGTGGGGATGTGG + Intergenic
1190055780 X:47180243-47180265 GATAGTGAGTGGTGGGTGCAGGG - Exonic
1191912265 X:66163650-66163672 CATTGTGTGTGGTGGTTTCATGG + Intronic
1192491113 X:71578332-71578354 CACTGTGATAGGTGGGTACAGGG + Intergenic
1193085064 X:77441636-77441658 CAGTGAGAGTTGTGGGTTTAAGG - Intergenic
1193250049 X:79280260-79280282 TATTGTAAGTGGTGGGTTGATGG + Intergenic
1195106200 X:101603719-101603741 CGTAGAGAGTGGTGGGTATCAGG - Intergenic
1195792895 X:108608156-108608178 CATTGTGGGTGGAGTGTAAATGG - Intronic
1196502889 X:116406108-116406130 TATTTTGTGTGGTGGTTATATGG - Intergenic
1196727288 X:118907746-118907768 AATTGTGTGTGGTGGGCATTTGG + Intergenic
1198934800 X:141894984-141895006 GAGTGGGAGTGGTGGGAATATGG + Intronic
1198957751 X:142150355-142150377 CCTGGTGGGTGGTGGGTGTAAGG - Intergenic
1200106373 X:153715523-153715545 CCTTGTGAGTGGGGGGTTGAGGG - Exonic