ID: 1102159593

View in Genome Browser
Species Human (GRCh38)
Location 12:110757700-110757722
Sequence TTTGTGCCTGGGCCCGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102159590_1102159593 17 Left 1102159590 12:110757660-110757682 CCACGTGGGTGGGGATTTTTGTC No data
Right 1102159593 12:110757700-110757722 TTTGTGCCTGGGCCCGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102159593 Original CRISPR TTTGTGCCTGGGCCCGTGCC TGG Intergenic
No off target data available for this crispr