ID: 1102162437

View in Genome Browser
Species Human (GRCh38)
Location 12:110780653-110780675
Sequence CCATCCACACAGGAGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102162437_1102162448 26 Left 1102162437 12:110780653-110780675 CCTTGCACCTCCTGTGTGGATGG No data
Right 1102162448 12:110780702-110780724 CTGTGTGAGAGACAGTTCTGAGG No data
1102162437_1102162447 3 Left 1102162437 12:110780653-110780675 CCTTGCACCTCCTGTGTGGATGG No data
Right 1102162447 12:110780679-110780701 ATGAGGAGTGGCTGCTGGCGGGG No data
1102162437_1102162446 2 Left 1102162437 12:110780653-110780675 CCTTGCACCTCCTGTGTGGATGG No data
Right 1102162446 12:110780678-110780700 GATGAGGAGTGGCTGCTGGCGGG No data
1102162437_1102162444 -2 Left 1102162437 12:110780653-110780675 CCTTGCACCTCCTGTGTGGATGG No data
Right 1102162444 12:110780674-110780696 GGGTGATGAGGAGTGGCTGCTGG No data
1102162437_1102162443 -9 Left 1102162437 12:110780653-110780675 CCTTGCACCTCCTGTGTGGATGG No data
Right 1102162443 12:110780667-110780689 TGTGGATGGGTGATGAGGAGTGG No data
1102162437_1102162445 1 Left 1102162437 12:110780653-110780675 CCTTGCACCTCCTGTGTGGATGG No data
Right 1102162445 12:110780677-110780699 TGATGAGGAGTGGCTGCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102162437 Original CRISPR CCATCCACACAGGAGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr