ID: 1102164847

View in Genome Browser
Species Human (GRCh38)
Location 12:110797892-110797914
Sequence ATGTGGGCATGGATGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102164847_1102164854 -3 Left 1102164847 12:110797892-110797914 CCCTCTTCCATCCATGCCCACAT No data
Right 1102164854 12:110797912-110797934 CATTGGTTTGACTTATCACCAGG No data
1102164847_1102164856 16 Left 1102164847 12:110797892-110797914 CCCTCTTCCATCCATGCCCACAT No data
Right 1102164856 12:110797931-110797953 CAGGCTTTTGTTGTGCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102164847 Original CRISPR ATGTGGGCATGGATGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr