ID: 1102166471

View in Genome Browser
Species Human (GRCh38)
Location 12:110810740-110810762
Sequence GAGACATGGCCAACATGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102166471_1102166475 15 Left 1102166471 12:110810740-110810762 CCTTGACATGTTGGCCATGTCTC No data
Right 1102166475 12:110810778-110810800 TGGCTGTCGCTGCCACTGCCAGG No data
1102166471_1102166473 -5 Left 1102166471 12:110810740-110810762 CCTTGACATGTTGGCCATGTCTC No data
Right 1102166473 12:110810758-110810780 GTCTCCTCATAGTCACAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102166471 Original CRISPR GAGACATGGCCAACATGTCA AGG (reversed) Intergenic
No off target data available for this crispr