ID: 1102166750

View in Genome Browser
Species Human (GRCh38)
Location 12:110813006-110813028
Sequence AAGAAGAAGGAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102166750_1102166761 25 Left 1102166750 12:110813006-110813028 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1102166761 12:110813054-110813076 CCATGGTGCCCAGGGCAGCCTGG No data
1102166750_1102166759 17 Left 1102166750 12:110813006-110813028 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1102166759 12:110813046-110813068 GGGTCTTGCCATGGTGCCCAGGG No data
1102166750_1102166762 26 Left 1102166750 12:110813006-110813028 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1102166762 12:110813055-110813077 CATGGTGCCCAGGGCAGCCTGGG No data
1102166750_1102166754 -5 Left 1102166750 12:110813006-110813028 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1102166754 12:110813024-110813046 TTCTTCTTTTTCTTTAGAAATGG No data
1102166750_1102166758 16 Left 1102166750 12:110813006-110813028 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1102166758 12:110813045-110813067 GGGGTCTTGCCATGGTGCCCAGG 0: 5
1: 519
2: 7292
3: 31176
4: 86709
1102166750_1102166755 -4 Left 1102166750 12:110813006-110813028 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1102166755 12:110813025-110813047 TCTTCTTTTTCTTTAGAAATGGG No data
1102166750_1102166757 8 Left 1102166750 12:110813006-110813028 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1102166757 12:110813037-110813059 TTAGAAATGGGGTCTTGCCATGG No data
1102166750_1102166756 -3 Left 1102166750 12:110813006-110813028 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1102166756 12:110813026-110813048 CTTCTTTTTCTTTAGAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102166750 Original CRISPR AAGAAGAAGGAGAAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr