ID: 1102173968

View in Genome Browser
Species Human (GRCh38)
Location 12:110862461-110862483
Sequence ACATTCTCCAAGGCAACGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102173968_1102173971 -6 Left 1102173968 12:110862461-110862483 CCAGCCGTTGCCTTGGAGAATGT 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1102173971 12:110862478-110862500 GAATGTCTCCCATTGTGCAGAGG 0: 1
1: 0
2: 1
3: 27
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102173968 Original CRISPR ACATTCTCCAAGGCAACGGC TGG (reversed) Intronic
913115609 1:115693554-115693576 ACATTCTCCTATGCAAAGACTGG - Exonic
924766405 1:247034948-247034970 ACATCCTCCTGGGGAACGGCTGG + Intergenic
1063102865 10:2965612-2965634 ACATTCGTCAAGTCAATGGCAGG + Intergenic
1063473131 10:6305106-6305128 ACATTTTGCAAGGCCAAGGCAGG - Intergenic
1072568760 10:96640476-96640498 TCATTCTCCAAGGTAAGGGCAGG + Intronic
1072577531 10:96713875-96713897 ACAGACTCCAAGTCAAGGGCTGG + Intronic
1074384218 10:113004397-113004419 ACATTCTCCAGGGGAAGGACTGG - Intronic
1085419215 11:76341242-76341264 ACTTTCTCCAAGGAAAGGTCTGG - Intergenic
1091803021 12:3336699-3336721 ACATTCTCCAGGCCCAGGGCAGG - Intergenic
1096742840 12:53706711-53706733 ACATTTTGCAAGGCCAAGGCGGG - Intergenic
1102173968 12:110862461-110862483 ACATTCTCCAAGGCAACGGCTGG - Intronic
1106113348 13:26796062-26796084 AAATTCTCCTAAGCAAAGGCTGG + Intergenic
1108081127 13:46737344-46737366 ACATTTTCGGAGGCAAAGGCAGG - Intronic
1108852675 13:54753232-54753254 AAATTCTCCAAGGCAATGCAAGG - Intergenic
1109685606 13:65815539-65815561 ACCTTCTCCAAGGAAACTGAGGG + Intergenic
1114495398 14:23128294-23128316 ACATCCTCAAGGGCAAAGGCTGG + Intronic
1120369027 14:83607979-83608001 CCAGTCTCCAGGGCACCGGCAGG + Intergenic
1122802263 14:104237658-104237680 CCCTTCTCCAGGGCAAAGGCAGG - Intergenic
1127297260 15:57619832-57619854 ACATTGCCCAAGACAAAGGCAGG + Intronic
1131726044 15:95226386-95226408 ACACTCTCCAAGTCAGGGGCTGG - Intergenic
1132569799 16:639069-639091 ACATTCTCCAAGGAGAGGTCAGG - Intronic
1133104109 16:3495583-3495605 ACAGTGCCCAAGGCAAGGGCAGG + Intergenic
1135244640 16:20845090-20845112 ACATTCTCACAGGCAAGGACTGG + Exonic
1136414045 16:30092716-30092738 ACATGATCAAAGACAACGGCTGG - Exonic
1141196940 16:81867158-81867180 ACCGTCTCCAGGGCAGCGGCTGG + Intronic
1141525177 16:84606591-84606613 ACCTTCTCCAAGGCCATGTCTGG + Intronic
1164869884 19:31633784-31633806 CCATTCTCCGAGACAAGGGCAGG - Intergenic
1168134518 19:54341509-54341531 AGATTCTCCATGGCAGAGGCTGG + Intergenic
931320318 2:61169371-61169393 ACATTCTCCCAGATAACTGCAGG + Intergenic
940809036 2:158222211-158222233 ACTTTCTCCAAGGCCAGTGCTGG - Intronic
948486713 2:238285963-238285985 GCACTCTCCATGGCAACGGTTGG + Intronic
1171445049 20:25196839-25196861 ACTCTCTCCAAGGCAAGGGGAGG - Intronic
1178583380 21:33854182-33854204 AGATTCTTCAAGGCAACTGTGGG + Intronic
1182048397 22:27294876-27294898 ACATGCTCCCAAGCAACGTCAGG - Intergenic
1182810824 22:33115281-33115303 ACAATCTCCAAGGCCAGGCCGGG + Intergenic
1184421808 22:44386539-44386561 ACATCTTCCCAGGCAACGCCTGG + Intergenic
1184519113 22:44982002-44982024 GCATTTGCCAAGGCAACGGGAGG - Intronic
1185066004 22:48632062-48632084 ACATTCTCCAGGGCCTAGGCCGG + Intronic
953988120 3:47461149-47461171 ACACTCTTCAAGGCAAAGGGTGG + Intronic
954921699 3:54196728-54196750 ACATTCACCTAGGCAAAGCCTGG - Intronic
955850836 3:63218041-63218063 AAATTCTCAAGGGCAACGGGAGG + Intergenic
958545574 3:95544888-95544910 ACATTCTCCATAACAAAGGCTGG + Intergenic
959427856 3:106215271-106215293 TCATTCTCCAAGGCCACAGCAGG - Intergenic
961519275 3:127457238-127457260 TCCTTCTCCAGGGCAGCGGCCGG - Intergenic
962175015 3:133143894-133143916 ACATTCTACAAGGGAAAGGAAGG + Intronic
964310263 3:155384921-155384943 ACATGCTTCAAGGAAAGGGCTGG - Intronic
970732263 4:19120236-19120258 CCCTTCTCCAAGGCAAAGGAGGG - Intergenic
975214391 4:71737142-71737164 GGATTCTCCAAGGAAACAGCAGG - Intergenic
976767196 4:88609965-88609987 ACAAACGCCATGGCAACGGCAGG - Intronic
977673245 4:99719576-99719598 ACCTTCTCCAAGGGAATGGCTGG + Intergenic
978223498 4:106305850-106305872 ACAAATTCCAAGGCAACGTCAGG + Intronic
987294341 5:16536893-16536915 ACATACTCCAAGGCCAAGGGTGG + Intronic
991106926 5:62854079-62854101 ACATTCTTCAAAGCAAAGGATGG + Intergenic
999421551 5:151448611-151448633 ACATTCTTCAAGTTAACGTCAGG - Intronic
1016914894 6:149235711-149235733 ACAAGCACCAAGGCAATGGCTGG - Intronic
1017947047 6:159104345-159104367 ACATCCTCCCAGGCATGGGCAGG - Intergenic
1018939639 6:168300571-168300593 ACAGTCTCCTAAGCAAGGGCAGG - Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1031875706 7:127138445-127138467 ATATTCTCCAAGTGAAGGGCTGG - Intronic
1034972439 7:155427611-155427633 GCCTTCTCCAAGACAACGTCAGG + Intergenic
1036182750 8:6598847-6598869 ACATTCTGCAATGCATCGGGCGG - Intronic
1040906205 8:52472127-52472149 ACATTTTGCAAGGCAAAGGCAGG + Intergenic
1046601363 8:116320789-116320811 AGAATCTCAAATGCAACGGCAGG + Intergenic
1048127679 8:131655542-131655564 ACATTCTCCAAGCCTACGTTGGG - Intergenic
1059057204 9:110996308-110996330 ACACTCTCCGAGGCCAAGGCAGG + Intronic
1062025093 9:134336551-134336573 ACATCCACCAAGGCTCCGGCCGG - Intronic
1062142065 9:134964736-134964758 ACATTCTCCCAGGGAACTGGGGG - Intergenic
1203773199 EBV:59679-59701 CCATTCTCCTGGGTAACGGCAGG - Intergenic
1203778216 EBV:85813-85835 ACATTCTCCAAGATAACGACGGG - Intergenic
1188022340 X:25172567-25172589 ACATTCTGCAAAGCACAGGCTGG - Intergenic
1195138162 X:101931715-101931737 ACCTTCTCTGAGGCAAGGGCGGG + Exonic
1196016723 X:110947381-110947403 ACATTCTCCAAAGCTTGGGCTGG + Intronic
1199029705 X:142982293-142982315 ACTTTCTCCCAGGTAATGGCAGG - Intergenic
1199859862 X:151791708-151791730 CCAATCTCCAAGGCAAAGTCAGG - Intergenic
1200888177 Y:8293083-8293105 ACATTCTCCAAGGCAGCCCATGG + Intergenic