ID: 1102182184

View in Genome Browser
Species Human (GRCh38)
Location 12:110920940-110920962
Sequence ATTCCAGGTAGAGGGCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102182184_1102182188 1 Left 1102182184 12:110920940-110920962 CCTGTGTGCCCTCTACCTGGAAT 0: 1
1: 0
2: 0
3: 21
4: 225
Right 1102182188 12:110920964-110920986 TCTTTCTGTCAGTCATCGCACGG 0: 1
1: 0
2: 2
3: 11
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102182184 Original CRISPR ATTCCAGGTAGAGGGCACAC AGG (reversed) Intergenic
901624435 1:10616048-10616070 ATTCCAGGGCTAGGACACACCGG + Intronic
902511432 1:16969032-16969054 ATGCCAGGTGGAGGTCACAGTGG + Intronic
905207623 1:36351910-36351932 AGTCCAGCTGGAGGGCACATGGG + Intronic
905254667 1:36672591-36672613 AGGCAAGGTAGAGGTCACACAGG - Intergenic
905267199 1:36762823-36762845 ATTCTAGGCAGAGGGAACAGGGG + Intergenic
905563827 1:38947683-38947705 CTTCCAGGTGGAGGCCACAGAGG - Intergenic
907185103 1:52603060-52603082 ATCCCTGGGAGAGGGCACAAAGG + Intronic
907225122 1:52939019-52939041 ATTCCAAGTAAAGGACACTCTGG - Intronic
907581222 1:55574531-55574553 ATTCCAGGGACAGGACACAGTGG + Intergenic
909669637 1:78173613-78173635 ATTTCAGGTAGAAGGCACAGAGG - Intergenic
910632185 1:89367262-89367284 ATTCCATGAACAGTGCACACAGG + Intronic
915110505 1:153561795-153561817 TGTCCAGGAGGAGGGCACACTGG - Intronic
917245138 1:172992629-172992651 AATCCAGGCAGAGGGAAGACTGG - Intergenic
918932960 1:190880236-190880258 GTTCCAGGTAGAAGTCACAGTGG - Intergenic
919086460 1:192926414-192926436 ATTCCAGACAGAGCACACACTGG - Intergenic
920163628 1:204019219-204019241 ATTCATGGTAGAAGGCACAGGGG - Intergenic
921227175 1:213031885-213031907 AATCCAGGTTGAAGGCTCACTGG - Intergenic
924253662 1:242160292-242160314 ATTCTAGGCAGATGGCCCACAGG + Intronic
1063222025 10:3977910-3977932 ATTCCAGGGAGAGAGGCCACTGG - Intergenic
1065204068 10:23341752-23341774 GTTCCAGGCAGAGAGAACACTGG - Intronic
1066048809 10:31617438-31617460 GATCCAGGTGGAGGGCACAGGGG - Intergenic
1067760625 10:49042957-49042979 ATTCCAGGAAGAGGGGAGAGTGG + Intronic
1070446798 10:76513026-76513048 ATGCAAAGTAGAGGGCAAACAGG - Intronic
1072463406 10:95641029-95641051 ATTCCAGGTAGAGGACAGGCAGG - Intronic
1073104974 10:101027330-101027352 ACTGCAGGCAGAGGGAACACTGG - Intronic
1076991430 11:278147-278169 CTTCCAGGTAGAGGGAACAGGGG - Intergenic
1077353046 11:2101562-2101584 ATTCCAGGAGGAGGGAACAGAGG - Intergenic
1077959230 11:7055709-7055731 ATTCTAGGTAGATGGAACATGGG + Intronic
1078390693 11:10933089-10933111 TTTCCAGGCAGAGGCCACAGAGG + Intergenic
1080464646 11:32485410-32485432 TTTCCAGGTGGAGGAAACACTGG + Intergenic
1081865336 11:46356589-46356611 ATTCCAGGTAGGGAGACCACCGG + Intronic
1082770143 11:57201573-57201595 ATTCCAGGTGGAGGGAAAGCAGG + Intergenic
1082782951 11:57301309-57301331 ATTGCAGGCAGAGGGAACAGGGG - Intronic
1083083484 11:60117885-60117907 ATTACAGGCAGATGGAACACAGG - Intergenic
1083273692 11:61585191-61585213 ATGCCAGGTAGAGGCCAGAGGGG - Intergenic
1084485843 11:69447680-69447702 ATCCCAGGCAGTGGGGACACAGG - Intergenic
1085179281 11:74520004-74520026 ATTCCAGGTAGAGGGAATAGTGG - Intronic
1086182037 11:83963802-83963824 ATTCTAGGTAGATGGTACAGTGG - Intronic
1087177909 11:95111869-95111891 ATGCAAGGTAAAGGGAACACTGG - Intronic
1087554171 11:99693516-99693538 ATGACAAGCAGAGGGCACACAGG + Intronic
1092693653 12:11144468-11144490 TTTCCAGGCAGAGGGCAAAATGG + Intronic
1093209580 12:16292309-16292331 ATTCCAGGAAGAGGGGAGAAAGG + Intergenic
1094034114 12:26048475-26048497 ATTCCAGTTAGAGGTGACTCAGG + Intronic
1096157405 12:49348150-49348172 GCTCCAGATAGAGGGGACACTGG + Intronic
1096798813 12:54095901-54095923 ATCCCAGGCAAAGGGCAGACAGG + Intergenic
1097340892 12:58436892-58436914 ATTCCAGATAGAGGGGATACAGG - Intergenic
1102182184 12:110920940-110920962 ATTCCAGGTAGAGGGCACACAGG - Intergenic
1102766862 12:115440848-115440870 ATGCCAGGCAGGGGCCACACCGG + Intergenic
1103558429 12:121779617-121779639 ATTCCAGGTAGAGAGCAGCTCGG + Exonic
1106666053 13:31852092-31852114 ATGCCATGCAGGGGGCACACAGG + Intergenic
1108719040 13:53111260-53111282 AGCCCAGGTAGAGGGCAGAGAGG + Intergenic
1113802425 13:113093533-113093555 TTTGCAGGCACAGGGCACACAGG + Intronic
1113803929 13:113102581-113102603 TTTGCAGGCACAGGGCACACAGG + Intergenic
1114057397 14:18984148-18984170 ATGCCAGAGAAAGGGCACACAGG - Intronic
1114105149 14:19417599-19417621 ATGCCAGAGAAAGGGCACACAGG + Intronic
1114318699 14:21528802-21528824 ATGGCAGGTAGAAGCCACACAGG - Intronic
1114405680 14:22453894-22453916 CTTCCAGGCAGAGGGGACACAGG + Intergenic
1118170841 14:63387003-63387025 ATTCCAGGTAGAGGGCATTAAGG + Intronic
1119197543 14:72728383-72728405 ATGCCAGATAAAGGGCACAGCGG + Intronic
1119597272 14:75946882-75946904 ACTCCAGGTGGAGGGAACAGCGG + Intronic
1120219654 14:81717880-81717902 GGTCCAATTAGAGGGCACACTGG + Intergenic
1121240572 14:92427198-92427220 CATCCAGGCAGAGGTCACACTGG + Intronic
1121423386 14:93831554-93831576 TTTCCAGTTAGAGGGCAAAGGGG - Intergenic
1121835540 14:97088848-97088870 ATTCCAGGTGGCAGGCACAGAGG + Intergenic
1123498063 15:20850272-20850294 ATGCCAGAGAAAGGGCACACAGG + Intronic
1123555294 15:21423900-21423922 ATGCCAGAGAAAGGGCACACAGG + Intronic
1123591539 15:21861231-21861253 ATGCCAGAGAAAGGGCACACAGG + Intergenic
1125660536 15:41391264-41391286 ATTCTAGGTACAGGGGAAACTGG + Intronic
1125896320 15:43305425-43305447 ATTCCAGGGCAAAGGCACACAGG + Intergenic
1126432470 15:48600901-48600923 ATCCCAGGTAGATGGCACAGGGG + Intronic
1127668222 15:61169797-61169819 ATTCCTGGTACAGGGCACCTGGG + Intronic
1127812730 15:62578672-62578694 ATTCCAGGTAGAGAGCTGAGAGG + Intronic
1129332020 15:74832608-74832630 ATTCCAGGGATAGTGCAAACTGG - Intergenic
1130158405 15:81374002-81374024 ATTCCTGGTAGAGGTAGCACTGG + Exonic
1131985295 15:98037622-98037644 CTTCCAGGGACAGGGCACAGTGG + Intergenic
1202963640 15_KI270727v1_random:151109-151131 ATGCCAGAGAAAGGGCACACAGG + Intergenic
1134043266 16:11083886-11083908 ATTCCGGGTAGAACACACACAGG - Intronic
1136293857 16:29290887-29290909 CATCCAGGGAGCGGGCACACAGG + Intergenic
1136455103 16:30375957-30375979 ATTCCAGGGAGAGGGCCAGCAGG - Intronic
1137686153 16:50388326-50388348 TTTCCAGGAAGAGCGCACACTGG - Intergenic
1137866196 16:51899120-51899142 CCTCCAGGCAGAGGGAACACTGG - Intergenic
1140136354 16:72209102-72209124 TTTCCAGGAAGAGGGCTCACCGG - Intergenic
1140707856 16:77647617-77647639 ATTACAGATTGAGGGCACATCGG - Intergenic
1141630923 16:85287556-85287578 ATTCCAGGCAGAGGGGGCAGCGG - Intergenic
1141658635 16:85429711-85429733 GTTCCAGGCAGAGGGAACAGTGG - Intergenic
1141921061 16:87135758-87135780 AGTCCAGGAAGAGGGCACTGTGG + Intronic
1142099758 16:88264933-88264955 CATCCAGGGAGCGGGCACACAGG + Intergenic
1142598222 17:1039877-1039899 CTTCCAGGGAGAGGTCACTCCGG + Intronic
1143964769 17:10749320-10749342 CTTGGTGGTAGAGGGCACACTGG + Intergenic
1144139727 17:12336764-12336786 TTTCCAGGTAGAGGGCATGATGG + Intergenic
1144457895 17:15433798-15433820 ATTCCAGTTAGAGGGCTCCTGGG + Intergenic
1144829883 17:18125329-18125351 ATTCTAGGCAGAGGCCACAGGGG - Intronic
1144841047 17:18185970-18185992 ATACAAGGTTGAGGACACACTGG + Intronic
1145225416 17:21124157-21124179 ATGCCAGGGAGAGGGGACAGTGG + Intronic
1146692213 17:34884266-34884288 TTTCCAGGCAGAGGGACCACAGG + Intergenic
1147253888 17:39170187-39170209 ATTTCAGGCAGAAGGCACATGGG + Intergenic
1151415697 17:73961174-73961196 ATTCCACGTTCAGGGCACAGTGG - Intergenic
1152288070 17:79423906-79423928 ATTCCGTGTAGAGGGCATAGTGG - Intronic
1154456064 18:14526701-14526723 ATGCCAGAGAAAGGGCACACAGG + Intronic
1155537656 18:26833543-26833565 CGCCCAGGTAGAGGGCACAGAGG + Intergenic
1156332459 18:36136199-36136221 AATCTAGGTAGAGGGTACAGGGG + Intronic
1159355494 18:67334176-67334198 ATGCCAGGGAGAAGGCCCACTGG + Intergenic
1159456462 18:68665679-68665701 ATTCTAGGTAGAGGGTACATAGG + Intergenic
1160380813 18:78453965-78453987 AATCCAGGCAGAGTGCAGACTGG + Intergenic
1161390200 19:4016729-4016751 ATTCCAGGCAGAGGGCAGTGAGG + Intronic
1161466660 19:4434566-4434588 ATTCCAGCTACAGGGCAATCTGG - Intronic
1161646500 19:5456412-5456434 CATCCAGGCAGATGGCACACAGG - Exonic
1162057486 19:8073359-8073381 ATTCCAGGTGGAGGGCTCTGGGG - Intronic
1162369291 19:10269499-10269521 CTTCCAGGTACTGGGGACACAGG - Intergenic
1162944981 19:14037611-14037633 ATTCCAGGAAGAGGAAACACAGG - Intronic
1163349267 19:16765101-16765123 AGTCCAGGTGAGGGGCACACAGG - Exonic
1166124230 19:40704072-40704094 AGTCCAGGTTCAGGGGACACAGG - Intronic
1167272940 19:48516677-48516699 ATTCCAGGCAGGGGCCACAGAGG + Intergenic
1167321059 19:48797330-48797352 ATTCCTGGTGGAGGGCAGTCTGG + Exonic
925377664 2:3399882-3399904 AGTCCAGGCAGGGGGCACGCAGG + Intronic
925621166 2:5794224-5794246 ATTCCAGGGACAGGGCCCAGAGG + Intergenic
925767869 2:7254472-7254494 ATTCCAAATAGAGGGCACTATGG - Intergenic
925953441 2:8937643-8937665 ACTCCAGACAGAGGGAACACAGG + Intronic
926215880 2:10905106-10905128 ATTCCAGGTGTGGGGCACTCTGG + Intergenic
927576642 2:24206835-24206857 GGTCCAGGTAGAAGTCACACTGG + Intronic
929782263 2:44964791-44964813 ACCCCAGGGAGAGGGAACACTGG - Intergenic
935890085 2:107667224-107667246 ATTCCAACTATAGGGCATACCGG - Intergenic
936281434 2:111143613-111143635 GTCCCAGGAAGCGGGCACACAGG + Intronic
936390121 2:112064847-112064869 ATTCAAGGTAGAAGCCAAACAGG - Intronic
938072177 2:128314561-128314583 ACACCAGGTGGACGGCACACAGG + Intronic
938283751 2:130089376-130089398 ATGCCAGAGACAGGGCACACAGG + Intronic
938284896 2:130103893-130103915 ATGCCAGAGAAAGGGCACACAGG + Intronic
938335539 2:130492445-130492467 ATGCCAGAGAAAGGGCACACAGG + Intronic
938354285 2:130628223-130628245 ATGCCAGAGAAAGGGCACACAGG - Intronic
938355427 2:130642726-130642748 ATGCCAGAGACAGGGCACACAGG - Intronic
938430708 2:131234997-131235019 ATGCCAGAGAAAGGGCACACAGG - Intronic
938431856 2:131249517-131249539 ATGCCAGAGACAGGGCACACAGG - Intronic
938475525 2:131608142-131608164 ATGCCAGAGAAAGGGCACACAGG - Intergenic
939162069 2:138602410-138602432 ATGCCAGGTAGATGGCACTGGGG - Intergenic
942806716 2:179939324-179939346 ATTTCAAGTGGAGGGTACACTGG + Intergenic
944602078 2:201313326-201313348 TTTCCAGGCAGTGGGCAAACAGG - Intronic
946290181 2:218738569-218738591 ATACCAGGAAGAGGCAACACTGG - Exonic
946525617 2:220516109-220516131 TTTGCAGGTAGAAGGCACAGGGG + Intergenic
946595633 2:221302956-221302978 ATTCTAGGCAGAGGGGACATGGG - Intergenic
946947793 2:224839658-224839680 AAACCAGGTAAAGGGCACATGGG + Intronic
947434235 2:230059172-230059194 ATTCCACGTTGAGGACACCCAGG + Exonic
947550417 2:231041566-231041588 ATGCCAGGCAGTGGGCACATGGG + Intronic
948943742 2:241209204-241209226 ATTCCAGGAGGAAGGAACACTGG + Intronic
1169046995 20:2541032-2541054 ATTCCAGGCAGAGGAAACAGGGG - Intronic
1169296134 20:4401605-4401627 ATTCAAGTCAAAGGGCACACAGG - Intergenic
1169432079 20:5545542-5545564 CTCCCAGGCAGAGGACACACGGG + Exonic
1170272440 20:14542751-14542773 AATCCAGGTAGTGGGTACATCGG + Intronic
1170522298 20:17199091-17199113 ATTCCAGGGGGAGGGAACAGAGG - Intergenic
1174348078 20:49946337-49946359 AATCTAGGTGAAGGGCACACAGG - Intronic
1175147915 20:56910764-56910786 ATTCCAGAGCCAGGGCACACAGG + Intergenic
1176037665 20:63048254-63048276 ATTTCAGGTTGGGGCCACACAGG - Intergenic
1176818098 21:13626639-13626661 ATGCCAGAGAAAGGGCACACAGG - Intronic
1177459223 21:21388394-21388416 ATTCCAGGCAGAGGGAACAAGGG + Intronic
1178155963 21:29854455-29854477 TTTCCAGGTAGAGGGAAGAGAGG + Intronic
1179379850 21:40888359-40888381 TGTCCAGGGAGTGGGCACACTGG + Intergenic
1180475886 22:15706757-15706779 ATGCCAGAGAAAGGGCACACAGG - Intronic
1180927087 22:19562954-19562976 TTTCCACGTACAGGGTACACTGG + Intergenic
1183381715 22:37493560-37493582 GTTCCAGGCAGAAGGCACAGAGG - Intronic
1183516538 22:38270158-38270180 GTTCCAGGTAGAGGGAACTCCGG - Intronic
1184114438 22:42414208-42414230 ATTCCAGGGAGCTGGCACCCGGG + Intronic
1184446963 22:44553759-44553781 GTTCCATGTATAGAGCACACAGG - Intergenic
950223206 3:11212479-11212501 AATCCAGGTAGAGGACCCACTGG + Intronic
954023661 3:47764579-47764601 ATTCCAGGCAGAGGGCATGCTGG - Intronic
955319925 3:57967033-57967055 CTTCCAGATAGAGGGAACACAGG - Intergenic
955472504 3:59300641-59300663 ATGCCAGGTGGAGCGGACACAGG + Intergenic
956398805 3:68854206-68854228 GCTCCAGGTGGAGGGAACACAGG + Intronic
957321354 3:78634959-78634981 ATTCCAGGTAAAGAATACACTGG - Intronic
960200509 3:114829652-114829674 ATTCTAGGTAGAAGTTACACGGG + Intronic
964021611 3:152020226-152020248 ATGCCAGAGAGAGGGCACATAGG + Intergenic
964242440 3:154612512-154612534 ATTCCAGGCAGAGGCTACAGTGG + Intergenic
964705548 3:159615139-159615161 ATTCCAGGAAGAAGGTACAGAGG + Intronic
965808219 3:172565116-172565138 ATTCCAGATGGAGAGCACTCAGG + Intergenic
967816159 3:193800139-193800161 ATTACAGGCAGAAGACACACTGG + Intergenic
968594397 4:1474753-1474775 ATTGGAGGGCGAGGGCACACAGG + Intergenic
968595426 4:1479778-1479800 ATCCCAGGTAGAGATCACATGGG + Intergenic
969377367 4:6771704-6771726 CTTCCAGAAAGAGGACACACTGG + Intergenic
969468652 4:7372789-7372811 ATTCCATGTATACGGCACTCCGG - Intronic
969577059 4:8042386-8042408 CCTCCAGGTATAGGGCACAGGGG - Intronic
970439177 4:16065326-16065348 ATTCCAGGTGGAGGGAACTGAGG - Intronic
971183170 4:24349676-24349698 TTTCCAGGTAGAGGGCAAGAGGG + Intergenic
971483323 4:27133887-27133909 TTTCCAGGGAGAGGGAACATGGG + Intergenic
973868143 4:55135573-55135595 ATTCCAGGAAAAAGGCAAACTGG - Intergenic
974887324 4:67835782-67835804 ATTCCAGATAGAAGGTACAGTGG + Intronic
976337563 4:83908284-83908306 ATTCCAAGTACAGGGCACAAAGG + Intergenic
976726224 4:88218084-88218106 ATTTCAGGTAGAGGGAACGGAGG - Intronic
977558132 4:98505319-98505341 TTGCCAGGTAGAGGCCAGACTGG - Intronic
978792565 4:112677999-112678021 ATTCCAGGCAGAAGACAAACAGG - Intergenic
980680276 4:136151635-136151657 GTTCCAGGTAGAGTCCACAATGG + Intergenic
983126046 4:163951425-163951447 CTTCCTGGTAGAGGATACACAGG + Intronic
984527591 4:180875631-180875653 TTTCCAGGCAGAGGGCAAAACGG + Intergenic
987212020 5:15693210-15693232 ATTCCAGGCAGACAGCTCACAGG - Intronic
988450841 5:31341576-31341598 AGTCCAGACAGAGGGAACACTGG - Intergenic
990045602 5:51426710-51426732 ATTCCATGTTTATGGCACACTGG + Intergenic
993865493 5:93189617-93189639 GTTCCAGGTAAAGGGCAAAGTGG - Intergenic
995317940 5:110797531-110797553 TTTCCAGGTAGTGGGCAAGCAGG + Intergenic
997106023 5:131019958-131019980 TTTCCAGGTAGTGGGCAAACAGG + Intergenic
1001548302 5:172584306-172584328 CTTCCAGGAAGAGGGAACAGAGG - Intergenic
1001879952 5:175234618-175234640 ATGCCAGGTGGTGGGCACCCAGG - Intergenic
1003720907 6:8701056-8701078 ATTCCAGGCAGAGGGAAGAGTGG - Intergenic
1003925779 6:10876497-10876519 ATTCCTTGTCGAGGGCACAGCGG - Exonic
1006147110 6:31966232-31966254 ATTCCAGGCACATGCCACACAGG + Intronic
1009320302 6:62279882-62279904 GTGCCAGGTAGAGGCCAAACAGG - Intronic
1012709552 6:102581972-102581994 GTTCCAGGTGGAGTACACACCGG + Intergenic
1012909589 6:105104139-105104161 ATTCCAAGTAGAGGGAAAAAAGG - Intronic
1014738734 6:125124221-125124243 TTTCCAGGCAGAGGGCACAATGG - Intronic
1015283753 6:131461885-131461907 ATTCCAGTTAGAAAGCAAACTGG + Intergenic
1017964855 6:159255293-159255315 ATTCCAGGTAGTGGGAATCCTGG - Intronic
1019163736 6:170085834-170085856 TCTCCACGTAGAGGGAACACAGG + Intergenic
1019812879 7:3177320-3177342 ATTCCTGGTAGAGGAACCACAGG - Intergenic
1021995377 7:26174767-26174789 CTTCCAGGAACAGGACACACTGG - Intronic
1023244299 7:38184260-38184282 ATTCCAGGCAGAGGGAGAACTGG + Intronic
1024283078 7:47735458-47735480 ATTCCAGGAAGAGGGGGAACAGG + Intronic
1025663198 7:63567971-63567993 ATGGCAGGTAGGGGGCACAAAGG + Intergenic
1025872989 7:65452513-65452535 CATCCAGGAAGAAGGCACACAGG + Intergenic
1031663822 7:124460328-124460350 ATTTCAGGGAGAGGAAACACTGG + Intergenic
1031957365 7:127955999-127956021 ATTCCAAGTAGAGAGCAGAAAGG - Intronic
1032406284 7:131658231-131658253 TTTCCACGTAGAGAGCTCACGGG - Intergenic
1032876637 7:136045353-136045375 ATTCCAGGCAGAGAACACAAGGG + Intergenic
1034648485 7:152670123-152670145 ATTCCAGGTAGAAGGAAAAAAGG - Intronic
1034740656 7:153470730-153470752 ATGCCAGGTAGAAGGTACAGAGG + Intergenic
1036503960 8:9338235-9338257 AGTCCAGGCAGAGGGGACACAGG - Intergenic
1036535440 8:9645620-9645642 AATCTAGGTAGAGGGGAAACAGG + Intronic
1036756058 8:11471818-11471840 AGACCAGGAAGAGGCCACACAGG - Intronic
1037291250 8:17351376-17351398 ATTCCAGCTATGGTGCACACAGG - Intronic
1039188231 8:34941573-34941595 ATTCCAGACACAGGGCACAGAGG + Intergenic
1039190758 8:34971594-34971616 CTTACAGGAAGAAGGCACACTGG - Intergenic
1040407878 8:47125871-47125893 ATGCCAGAGAAAGGGCACACAGG + Intergenic
1042292009 8:67178703-67178725 ATTCCAGGAAGAGGCCCCAGTGG + Intronic
1042301385 8:67286276-67286298 AATCCAGATAAAGGACACACAGG + Intronic
1046074373 8:109299367-109299389 TTTCCAGGTAGTGGGCAAGCAGG - Intronic
1046914132 8:119661551-119661573 ATTCCATGAAGAGTGCACAAGGG - Intronic
1049683240 8:143929104-143929126 TCTCCAGGTAGATGGCAGACAGG + Exonic
1049872868 8:144994628-144994650 ATCCCAGGTAGAGGGCAGGATGG + Intergenic
1053221324 9:36315676-36315698 CTTCCCGGTGGAGGGCACAAGGG + Intergenic
1061714964 9:132513306-132513328 AATCCAGGTAGTGGGTTCACGGG - Intronic
1062082857 9:134633644-134633666 TTTCCAGGGAGAGGGGAGACGGG - Intergenic
1203529261 Un_GL000213v1:122865-122887 ATGCCAGAGAAAGGGCACACAGG + Intergenic
1187867030 X:23732485-23732507 AATCCAGGTGGTGGGTACACAGG + Intronic
1188612367 X:32116184-32116206 ATTCCAGGCAGAGGAAACAAGGG - Intronic
1190733982 X:53243225-53243247 ATTGCAGGTAAAGGGCACCTGGG + Intronic
1192194369 X:69018629-69018651 GTTCCATGAAGGGGGCACACAGG + Intergenic
1193602107 X:83520122-83520144 ATACTAGGTAAAGGGCACATGGG + Intergenic
1194701535 X:97119919-97119941 TTTCCAGGCAGTGGGCAAACAGG + Intronic
1196948315 X:120850472-120850494 TTTCCAGGTAGTGGGCAAGCAGG + Intergenic
1198160182 X:134000233-134000255 CATCCAGGAAGAAGGCACACAGG - Intergenic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1201610661 Y:15839720-15839742 ACTCCAGGGAGGGAGCACACAGG + Intergenic