ID: 1102183722

View in Genome Browser
Species Human (GRCh38)
Location 12:110932043-110932065
Sequence CTGCTCGTAGAGTTTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102183715_1102183722 22 Left 1102183715 12:110931998-110932020 CCATCGACATACAGAGCAATTCC No data
Right 1102183722 12:110932043-110932065 CTGCTCGTAGAGTTTGAGGATGG No data
1102183720_1102183722 1 Left 1102183720 12:110932019-110932041 CCTAGGAAGGGAGAGACAGGTTT No data
Right 1102183722 12:110932043-110932065 CTGCTCGTAGAGTTTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102183722 Original CRISPR CTGCTCGTAGAGTTTGAGGA TGG Intergenic
No off target data available for this crispr