ID: 1102185223

View in Genome Browser
Species Human (GRCh38)
Location 12:110942341-110942363
Sequence AGATACCTAGGAAGGATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102185223_1102185228 15 Left 1102185223 12:110942341-110942363 CCCTTTATCCTTCCTAGGTATCT No data
Right 1102185228 12:110942379-110942401 TTGCAAGTTCACTTCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102185223 Original CRISPR AGATACCTAGGAAGGATAAA GGG (reversed) Intergenic
No off target data available for this crispr