ID: 1102185226

View in Genome Browser
Species Human (GRCh38)
Location 12:110942353-110942375
Sequence ATTTATTGAGGAAGATACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102185226_1102185228 3 Left 1102185226 12:110942353-110942375 CCTAGGTATCTTCCTCAATAAAT No data
Right 1102185228 12:110942379-110942401 TTGCAAGTTCACTTCCATCTTGG No data
1102185226_1102185232 30 Left 1102185226 12:110942353-110942375 CCTAGGTATCTTCCTCAATAAAT No data
Right 1102185232 12:110942406-110942428 TGCTTCCCAGAGGGCTGACCTGG No data
1102185226_1102185231 21 Left 1102185226 12:110942353-110942375 CCTAGGTATCTTCCTCAATAAAT No data
Right 1102185231 12:110942397-110942419 CTTGGTGTCTGCTTCCCAGAGGG No data
1102185226_1102185230 20 Left 1102185226 12:110942353-110942375 CCTAGGTATCTTCCTCAATAAAT No data
Right 1102185230 12:110942396-110942418 TCTTGGTGTCTGCTTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102185226 Original CRISPR ATTTATTGAGGAAGATACCT AGG (reversed) Intergenic
No off target data available for this crispr