ID: 1102185228

View in Genome Browser
Species Human (GRCh38)
Location 12:110942379-110942401
Sequence TTGCAAGTTCACTTCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102185221_1102185228 19 Left 1102185221 12:110942337-110942359 CCTCCCCTTTATCCTTCCTAGGT No data
Right 1102185228 12:110942379-110942401 TTGCAAGTTCACTTCCATCTTGG No data
1102185219_1102185228 20 Left 1102185219 12:110942336-110942358 CCCTCCCCTTTATCCTTCCTAGG No data
Right 1102185228 12:110942379-110942401 TTGCAAGTTCACTTCCATCTTGG No data
1102185225_1102185228 7 Left 1102185225 12:110942349-110942371 CCTTCCTAGGTATCTTCCTCAAT No data
Right 1102185228 12:110942379-110942401 TTGCAAGTTCACTTCCATCTTGG No data
1102185218_1102185228 21 Left 1102185218 12:110942335-110942357 CCCCTCCCCTTTATCCTTCCTAG No data
Right 1102185228 12:110942379-110942401 TTGCAAGTTCACTTCCATCTTGG No data
1102185222_1102185228 16 Left 1102185222 12:110942340-110942362 CCCCTTTATCCTTCCTAGGTATC No data
Right 1102185228 12:110942379-110942401 TTGCAAGTTCACTTCCATCTTGG No data
1102185227_1102185228 -9 Left 1102185227 12:110942365-110942387 CCTCAATAAATCTCTTGCAAGTT No data
Right 1102185228 12:110942379-110942401 TTGCAAGTTCACTTCCATCTTGG No data
1102185217_1102185228 29 Left 1102185217 12:110942327-110942349 CCTGGCTTCCCCTCCCCTTTATC No data
Right 1102185228 12:110942379-110942401 TTGCAAGTTCACTTCCATCTTGG No data
1102185226_1102185228 3 Left 1102185226 12:110942353-110942375 CCTAGGTATCTTCCTCAATAAAT No data
Right 1102185228 12:110942379-110942401 TTGCAAGTTCACTTCCATCTTGG No data
1102185224_1102185228 14 Left 1102185224 12:110942342-110942364 CCTTTATCCTTCCTAGGTATCTT No data
Right 1102185228 12:110942379-110942401 TTGCAAGTTCACTTCCATCTTGG No data
1102185223_1102185228 15 Left 1102185223 12:110942341-110942363 CCCTTTATCCTTCCTAGGTATCT No data
Right 1102185228 12:110942379-110942401 TTGCAAGTTCACTTCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102185228 Original CRISPR TTGCAAGTTCACTTCCATCT TGG Intergenic
No off target data available for this crispr