ID: 1102185229

View in Genome Browser
Species Human (GRCh38)
Location 12:110942393-110942415
Sequence CTGGGAAGCAGACACCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102185229_1102185235 0 Left 1102185229 12:110942393-110942415 CCATCTTGGTGTCTGCTTCCCAG No data
Right 1102185235 12:110942416-110942438 AGGGCTGACCTGGAACTCTGAGG No data
1102185229_1102185232 -10 Left 1102185229 12:110942393-110942415 CCATCTTGGTGTCTGCTTCCCAG No data
Right 1102185232 12:110942406-110942428 TGCTTCCCAGAGGGCTGACCTGG No data
1102185229_1102185236 1 Left 1102185229 12:110942393-110942415 CCATCTTGGTGTCTGCTTCCCAG No data
Right 1102185236 12:110942417-110942439 GGGCTGACCTGGAACTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102185229 Original CRISPR CTGGGAAGCAGACACCAAGA TGG (reversed) Intergenic
No off target data available for this crispr