ID: 1102185230

View in Genome Browser
Species Human (GRCh38)
Location 12:110942396-110942418
Sequence TCTTGGTGTCTGCTTCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102185226_1102185230 20 Left 1102185226 12:110942353-110942375 CCTAGGTATCTTCCTCAATAAAT No data
Right 1102185230 12:110942396-110942418 TCTTGGTGTCTGCTTCCCAGAGG No data
1102185227_1102185230 8 Left 1102185227 12:110942365-110942387 CCTCAATAAATCTCTTGCAAGTT No data
Right 1102185230 12:110942396-110942418 TCTTGGTGTCTGCTTCCCAGAGG No data
1102185225_1102185230 24 Left 1102185225 12:110942349-110942371 CCTTCCTAGGTATCTTCCTCAAT No data
Right 1102185230 12:110942396-110942418 TCTTGGTGTCTGCTTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102185230 Original CRISPR TCTTGGTGTCTGCTTCCCAG AGG Intergenic
No off target data available for this crispr