ID: 1102185235

View in Genome Browser
Species Human (GRCh38)
Location 12:110942416-110942438
Sequence AGGGCTGACCTGGAACTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102185227_1102185235 28 Left 1102185227 12:110942365-110942387 CCTCAATAAATCTCTTGCAAGTT No data
Right 1102185235 12:110942416-110942438 AGGGCTGACCTGGAACTCTGAGG No data
1102185229_1102185235 0 Left 1102185229 12:110942393-110942415 CCATCTTGGTGTCTGCTTCCCAG No data
Right 1102185235 12:110942416-110942438 AGGGCTGACCTGGAACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102185235 Original CRISPR AGGGCTGACCTGGAACTCTG AGG Intergenic
No off target data available for this crispr