ID: 1102185236

View in Genome Browser
Species Human (GRCh38)
Location 12:110942417-110942439
Sequence GGGCTGACCTGGAACTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102185229_1102185236 1 Left 1102185229 12:110942393-110942415 CCATCTTGGTGTCTGCTTCCCAG No data
Right 1102185236 12:110942417-110942439 GGGCTGACCTGGAACTCTGAGGG No data
1102185227_1102185236 29 Left 1102185227 12:110942365-110942387 CCTCAATAAATCTCTTGCAAGTT No data
Right 1102185236 12:110942417-110942439 GGGCTGACCTGGAACTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102185236 Original CRISPR GGGCTGACCTGGAACTCTGA GGG Intergenic
No off target data available for this crispr