ID: 1102187027

View in Genome Browser
Species Human (GRCh38)
Location 12:110957057-110957079
Sequence CGGGCTCCATCTCGAGTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102187026_1102187027 -9 Left 1102187026 12:110957043-110957065 CCACAGAGGGAAAGCGGGCTCCA No data
Right 1102187027 12:110957057-110957079 CGGGCTCCATCTCGAGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102187027 Original CRISPR CGGGCTCCATCTCGAGTTTA TGG Intergenic
No off target data available for this crispr