ID: 1102192468

View in Genome Browser
Species Human (GRCh38)
Location 12:110999086-110999108
Sequence TGGGTGTGAGTCCTGGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102192468_1102192479 16 Left 1102192468 12:110999086-110999108 CCAAGAACCAGGACTCACACCCA No data
Right 1102192479 12:110999125-110999147 AGACCAGCTGGTGATCCCTCTGG No data
1102192468_1102192476 4 Left 1102192468 12:110999086-110999108 CCAAGAACCAGGACTCACACCCA No data
Right 1102192476 12:110999113-110999135 CTGGGATCTCCCAGACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102192468 Original CRISPR TGGGTGTGAGTCCTGGTTCT TGG (reversed) Intergenic
No off target data available for this crispr