ID: 1102192469

View in Genome Browser
Species Human (GRCh38)
Location 12:110999093-110999115
Sequence CAGGGACTGGGTGTGAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102192469_1102192482 24 Left 1102192469 12:110999093-110999115 CCAGGACTCACACCCAGTCCCTG No data
Right 1102192482 12:110999140-110999162 CCCTCTGGTCATGCCAGTCAAGG No data
1102192469_1102192479 9 Left 1102192469 12:110999093-110999115 CCAGGACTCACACCCAGTCCCTG No data
Right 1102192479 12:110999125-110999147 AGACCAGCTGGTGATCCCTCTGG No data
1102192469_1102192476 -3 Left 1102192469 12:110999093-110999115 CCAGGACTCACACCCAGTCCCTG No data
Right 1102192476 12:110999113-110999135 CTGGGATCTCCCAGACCAGCTGG No data
1102192469_1102192484 25 Left 1102192469 12:110999093-110999115 CCAGGACTCACACCCAGTCCCTG No data
Right 1102192484 12:110999141-110999163 CCTCTGGTCATGCCAGTCAAGGG No data
1102192469_1102192485 26 Left 1102192469 12:110999093-110999115 CCAGGACTCACACCCAGTCCCTG No data
Right 1102192485 12:110999142-110999164 CTCTGGTCATGCCAGTCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102192469 Original CRISPR CAGGGACTGGGTGTGAGTCC TGG (reversed) Intergenic
No off target data available for this crispr