ID: 1102192477

View in Genome Browser
Species Human (GRCh38)
Location 12:110999122-110999144
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102192477_1102192484 -4 Left 1102192477 12:110999122-110999144 CCCAGACCAGCTGGTGATCCCTC No data
Right 1102192484 12:110999141-110999163 CCTCTGGTCATGCCAGTCAAGGG No data
1102192477_1102192487 18 Left 1102192477 12:110999122-110999144 CCCAGACCAGCTGGTGATCCCTC No data
Right 1102192487 12:110999163-110999185 GGCCAAAATGCCCATCCCAGTGG No data
1102192477_1102192485 -3 Left 1102192477 12:110999122-110999144 CCCAGACCAGCTGGTGATCCCTC No data
Right 1102192485 12:110999142-110999164 CTCTGGTCATGCCAGTCAAGGGG No data
1102192477_1102192482 -5 Left 1102192477 12:110999122-110999144 CCCAGACCAGCTGGTGATCCCTC No data
Right 1102192482 12:110999140-110999162 CCCTCTGGTCATGCCAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102192477 Original CRISPR GAGGGATCACCAGCTGGTCT GGG (reversed) Intergenic
No off target data available for this crispr