ID: 1102192478

View in Genome Browser
Species Human (GRCh38)
Location 12:110999123-110999145
Sequence AGAGGGATCACCAGCTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102192478_1102192487 17 Left 1102192478 12:110999123-110999145 CCAGACCAGCTGGTGATCCCTCT No data
Right 1102192487 12:110999163-110999185 GGCCAAAATGCCCATCCCAGTGG No data
1102192478_1102192485 -4 Left 1102192478 12:110999123-110999145 CCAGACCAGCTGGTGATCCCTCT No data
Right 1102192485 12:110999142-110999164 CTCTGGTCATGCCAGTCAAGGGG No data
1102192478_1102192482 -6 Left 1102192478 12:110999123-110999145 CCAGACCAGCTGGTGATCCCTCT No data
Right 1102192482 12:110999140-110999162 CCCTCTGGTCATGCCAGTCAAGG No data
1102192478_1102192484 -5 Left 1102192478 12:110999123-110999145 CCAGACCAGCTGGTGATCCCTCT No data
Right 1102192484 12:110999141-110999163 CCTCTGGTCATGCCAGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102192478 Original CRISPR AGAGGGATCACCAGCTGGTC TGG (reversed) Intergenic
No off target data available for this crispr