ID: 1102192479

View in Genome Browser
Species Human (GRCh38)
Location 12:110999125-110999147
Sequence AGACCAGCTGGTGATCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102192475_1102192479 -10 Left 1102192475 12:110999112-110999134 CCTGGGATCTCCCAGACCAGCTG No data
Right 1102192479 12:110999125-110999147 AGACCAGCTGGTGATCCCTCTGG No data
1102192468_1102192479 16 Left 1102192468 12:110999086-110999108 CCAAGAACCAGGACTCACACCCA No data
Right 1102192479 12:110999125-110999147 AGACCAGCTGGTGATCCCTCTGG No data
1102192472_1102192479 -3 Left 1102192472 12:110999105-110999127 CCCAGTCCCTGGGATCTCCCAGA No data
Right 1102192479 12:110999125-110999147 AGACCAGCTGGTGATCCCTCTGG No data
1102192474_1102192479 -9 Left 1102192474 12:110999111-110999133 CCCTGGGATCTCCCAGACCAGCT No data
Right 1102192479 12:110999125-110999147 AGACCAGCTGGTGATCCCTCTGG No data
1102192473_1102192479 -4 Left 1102192473 12:110999106-110999128 CCAGTCCCTGGGATCTCCCAGAC No data
Right 1102192479 12:110999125-110999147 AGACCAGCTGGTGATCCCTCTGG No data
1102192469_1102192479 9 Left 1102192469 12:110999093-110999115 CCAGGACTCACACCCAGTCCCTG No data
Right 1102192479 12:110999125-110999147 AGACCAGCTGGTGATCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102192479 Original CRISPR AGACCAGCTGGTGATCCCTC TGG Intergenic
No off target data available for this crispr