ID: 1102192481

View in Genome Browser
Species Human (GRCh38)
Location 12:110999140-110999162
Sequence CCTTGACTGGCATGACCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102192481_1102192494 22 Left 1102192481 12:110999140-110999162 CCCTCTGGTCATGCCAGTCAAGG No data
Right 1102192494 12:110999185-110999207 GCTGCCTCCCCTCGCCTGCAGGG No data
1102192481_1102192493 21 Left 1102192481 12:110999140-110999162 CCCTCTGGTCATGCCAGTCAAGG No data
Right 1102192493 12:110999184-110999206 GGCTGCCTCCCCTCGCCTGCAGG No data
1102192481_1102192487 0 Left 1102192481 12:110999140-110999162 CCCTCTGGTCATGCCAGTCAAGG No data
Right 1102192487 12:110999163-110999185 GGCCAAAATGCCCATCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102192481 Original CRISPR CCTTGACTGGCATGACCAGA GGG (reversed) Intergenic
No off target data available for this crispr