ID: 1102192484

View in Genome Browser
Species Human (GRCh38)
Location 12:110999141-110999163
Sequence CCTCTGGTCATGCCAGTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102192469_1102192484 25 Left 1102192469 12:110999093-110999115 CCAGGACTCACACCCAGTCCCTG No data
Right 1102192484 12:110999141-110999163 CCTCTGGTCATGCCAGTCAAGGG No data
1102192474_1102192484 7 Left 1102192474 12:110999111-110999133 CCCTGGGATCTCCCAGACCAGCT No data
Right 1102192484 12:110999141-110999163 CCTCTGGTCATGCCAGTCAAGGG No data
1102192480_1102192484 -10 Left 1102192480 12:110999128-110999150 CCAGCTGGTGATCCCTCTGGTCA No data
Right 1102192484 12:110999141-110999163 CCTCTGGTCATGCCAGTCAAGGG No data
1102192475_1102192484 6 Left 1102192475 12:110999112-110999134 CCTGGGATCTCCCAGACCAGCTG No data
Right 1102192484 12:110999141-110999163 CCTCTGGTCATGCCAGTCAAGGG No data
1102192473_1102192484 12 Left 1102192473 12:110999106-110999128 CCAGTCCCTGGGATCTCCCAGAC No data
Right 1102192484 12:110999141-110999163 CCTCTGGTCATGCCAGTCAAGGG No data
1102192478_1102192484 -5 Left 1102192478 12:110999123-110999145 CCAGACCAGCTGGTGATCCCTCT No data
Right 1102192484 12:110999141-110999163 CCTCTGGTCATGCCAGTCAAGGG No data
1102192477_1102192484 -4 Left 1102192477 12:110999122-110999144 CCCAGACCAGCTGGTGATCCCTC No data
Right 1102192484 12:110999141-110999163 CCTCTGGTCATGCCAGTCAAGGG No data
1102192472_1102192484 13 Left 1102192472 12:110999105-110999127 CCCAGTCCCTGGGATCTCCCAGA No data
Right 1102192484 12:110999141-110999163 CCTCTGGTCATGCCAGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102192484 Original CRISPR CCTCTGGTCATGCCAGTCAA GGG Intergenic
No off target data available for this crispr