ID: 1102192485

View in Genome Browser
Species Human (GRCh38)
Location 12:110999142-110999164
Sequence CTCTGGTCATGCCAGTCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102192469_1102192485 26 Left 1102192469 12:110999093-110999115 CCAGGACTCACACCCAGTCCCTG No data
Right 1102192485 12:110999142-110999164 CTCTGGTCATGCCAGTCAAGGGG No data
1102192475_1102192485 7 Left 1102192475 12:110999112-110999134 CCTGGGATCTCCCAGACCAGCTG No data
Right 1102192485 12:110999142-110999164 CTCTGGTCATGCCAGTCAAGGGG No data
1102192473_1102192485 13 Left 1102192473 12:110999106-110999128 CCAGTCCCTGGGATCTCCCAGAC No data
Right 1102192485 12:110999142-110999164 CTCTGGTCATGCCAGTCAAGGGG No data
1102192474_1102192485 8 Left 1102192474 12:110999111-110999133 CCCTGGGATCTCCCAGACCAGCT No data
Right 1102192485 12:110999142-110999164 CTCTGGTCATGCCAGTCAAGGGG No data
1102192478_1102192485 -4 Left 1102192478 12:110999123-110999145 CCAGACCAGCTGGTGATCCCTCT No data
Right 1102192485 12:110999142-110999164 CTCTGGTCATGCCAGTCAAGGGG No data
1102192477_1102192485 -3 Left 1102192477 12:110999122-110999144 CCCAGACCAGCTGGTGATCCCTC No data
Right 1102192485 12:110999142-110999164 CTCTGGTCATGCCAGTCAAGGGG No data
1102192480_1102192485 -9 Left 1102192480 12:110999128-110999150 CCAGCTGGTGATCCCTCTGGTCA No data
Right 1102192485 12:110999142-110999164 CTCTGGTCATGCCAGTCAAGGGG No data
1102192472_1102192485 14 Left 1102192472 12:110999105-110999127 CCCAGTCCCTGGGATCTCCCAGA No data
Right 1102192485 12:110999142-110999164 CTCTGGTCATGCCAGTCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102192485 Original CRISPR CTCTGGTCATGCCAGTCAAG GGG Intergenic
No off target data available for this crispr