ID: 1102192487

View in Genome Browser
Species Human (GRCh38)
Location 12:110999163-110999185
Sequence GGCCAAAATGCCCATCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102192480_1102192487 12 Left 1102192480 12:110999128-110999150 CCAGCTGGTGATCCCTCTGGTCA No data
Right 1102192487 12:110999163-110999185 GGCCAAAATGCCCATCCCAGTGG No data
1102192475_1102192487 28 Left 1102192475 12:110999112-110999134 CCTGGGATCTCCCAGACCAGCTG No data
Right 1102192487 12:110999163-110999185 GGCCAAAATGCCCATCCCAGTGG No data
1102192477_1102192487 18 Left 1102192477 12:110999122-110999144 CCCAGACCAGCTGGTGATCCCTC No data
Right 1102192487 12:110999163-110999185 GGCCAAAATGCCCATCCCAGTGG No data
1102192474_1102192487 29 Left 1102192474 12:110999111-110999133 CCCTGGGATCTCCCAGACCAGCT No data
Right 1102192487 12:110999163-110999185 GGCCAAAATGCCCATCCCAGTGG No data
1102192481_1102192487 0 Left 1102192481 12:110999140-110999162 CCCTCTGGTCATGCCAGTCAAGG No data
Right 1102192487 12:110999163-110999185 GGCCAAAATGCCCATCCCAGTGG No data
1102192483_1102192487 -1 Left 1102192483 12:110999141-110999163 CCTCTGGTCATGCCAGTCAAGGG No data
Right 1102192487 12:110999163-110999185 GGCCAAAATGCCCATCCCAGTGG No data
1102192478_1102192487 17 Left 1102192478 12:110999123-110999145 CCAGACCAGCTGGTGATCCCTCT No data
Right 1102192487 12:110999163-110999185 GGCCAAAATGCCCATCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102192487 Original CRISPR GGCCAAAATGCCCATCCCAG TGG Intergenic
No off target data available for this crispr