ID: 1102194311

View in Genome Browser
Species Human (GRCh38)
Location 12:111013560-111013582
Sequence CTCACTCCTCAGACAGGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102194302_1102194311 24 Left 1102194302 12:111013513-111013535 CCCTTGGCAATGACTGATGGCTG No data
Right 1102194311 12:111013560-111013582 CTCACTCCTCAGACAGGATAAGG No data
1102194301_1102194311 25 Left 1102194301 12:111013512-111013534 CCCCTTGGCAATGACTGATGGCT No data
Right 1102194311 12:111013560-111013582 CTCACTCCTCAGACAGGATAAGG No data
1102194303_1102194311 23 Left 1102194303 12:111013514-111013536 CCTTGGCAATGACTGATGGCTGT No data
Right 1102194311 12:111013560-111013582 CTCACTCCTCAGACAGGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102194311 Original CRISPR CTCACTCCTCAGACAGGATA AGG Intergenic
No off target data available for this crispr