ID: 1102196701

View in Genome Browser
Species Human (GRCh38)
Location 12:111030674-111030696
Sequence GTGCCTGTGCTTATTAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 110}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102196701_1102196707 10 Left 1102196701 12:111030674-111030696 CCACATCTAATAAGCACAGGCAC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1102196707 12:111030707-111030729 TGGAATATGGTGGGGAGAGACGG 0: 1
1: 0
2: 3
3: 58
4: 552
1102196701_1102196704 0 Left 1102196701 12:111030674-111030696 CCACATCTAATAAGCACAGGCAC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1102196704 12:111030697-111030719 ACGATGCAGTTGGAATATGGTGG 0: 1
1: 0
2: 0
3: 4
4: 96
1102196701_1102196705 1 Left 1102196701 12:111030674-111030696 CCACATCTAATAAGCACAGGCAC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1102196705 12:111030698-111030720 CGATGCAGTTGGAATATGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 78
1102196701_1102196702 -10 Left 1102196701 12:111030674-111030696 CCACATCTAATAAGCACAGGCAC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1102196702 12:111030687-111030709 GCACAGGCACACGATGCAGTTGG 0: 1
1: 0
2: 1
3: 12
4: 102
1102196701_1102196706 2 Left 1102196701 12:111030674-111030696 CCACATCTAATAAGCACAGGCAC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1102196706 12:111030699-111030721 GATGCAGTTGGAATATGGTGGGG 0: 1
1: 0
2: 1
3: 22
4: 159
1102196701_1102196703 -3 Left 1102196701 12:111030674-111030696 CCACATCTAATAAGCACAGGCAC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1102196703 12:111030694-111030716 CACACGATGCAGTTGGAATATGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102196701 Original CRISPR GTGCCTGTGCTTATTAGATG TGG (reversed) Intergenic
902161464 1:14533954-14533976 GTGCCTATCTTTATTAGCTGGGG - Intergenic
902906491 1:19561997-19562019 TTGACTGTTCTCATTAGATGTGG - Intergenic
904629578 1:31830827-31830849 GTGCTTGTGCTTATGAAAAGTGG + Intergenic
906557540 1:46725442-46725464 GACACTGTGCTTCTTAGATGGGG + Intergenic
906602301 1:47140835-47140857 GTGCCTGTCCTTATTGGATATGG + Exonic
909671207 1:78190631-78190653 GTTCCTGTGTTTATTTGCTGAGG + Intergenic
913588417 1:120299281-120299303 GTGCCTGTGTTAATTAGCTTAGG - Intergenic
913619768 1:120599088-120599110 GTGCCTGTGTTAATTAGCTTAGG + Intergenic
914602396 1:149219115-149219137 GTGCCTGTGTTAATTAGCTTAGG + Intergenic
916306934 1:163346838-163346860 GTGTGTGTGCTTTTCAGATGGGG - Intronic
916395074 1:164377759-164377781 TTTCCTGTGCTTATTTGATCAGG - Intergenic
916770372 1:167901947-167901969 GTGCCTGTGCTTCTGTGTTGGGG - Intronic
920762312 1:208796874-208796896 GAGCATATGCTTATTTGATGTGG - Intergenic
920938147 1:210455254-210455276 GTGCCTGTGCTTCTTTGACCTGG + Intronic
922299840 1:224288723-224288745 GTGCCTTTGATTATAAAATGGGG + Intronic
1063558281 10:7101443-7101465 GTGCATTTCCTTATGAGATGTGG - Intergenic
1064848399 10:19682577-19682599 ATGCCAGAGCTAATTAGATGTGG + Intronic
1074656306 10:115592049-115592071 GTTCCTGTGCTAATTAGCTTAGG - Intronic
1076424593 10:130358641-130358663 GTGCCTTTGCTCACTAGAAGTGG + Intergenic
1077455488 11:2676095-2676117 GTGCATGTACTTAGTAGATACGG + Intronic
1078127633 11:8584032-8584054 GTGACTGTACTGATTAGATCTGG - Intronic
1078656680 11:13247130-13247152 GTGCCTGTGTCTATAAGATGGGG - Intergenic
1080832248 11:35906236-35906258 GTGCCTGGGATGATTTGATGTGG - Intergenic
1091004308 11:131938689-131938711 GTGGCTGTGCCTATAAGAGGTGG + Intronic
1092229345 12:6768031-6768053 GTGCCTGTGTTGAGTAAATGAGG + Intronic
1098269491 12:68755980-68756002 GTGTTTCTGCTTATTAGCTGTGG - Intronic
1102170273 12:110837077-110837099 ATGCATATGCTTAATAGATGTGG + Intergenic
1102196701 12:111030674-111030696 GTGCCTGTGCTTATTAGATGTGG - Intergenic
1103285537 12:119798280-119798302 GTTCATGTGCTTGTTAGAAGTGG - Intronic
1115921060 14:38373795-38373817 GTGCCTGTGTGTATTTGAGGTGG - Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1126218383 15:46183583-46183605 CTGCCTGGGCTTATTGGGTGGGG + Intergenic
1127058517 15:55157509-55157531 GTGCCTGGGCCTACTTGATGGGG + Intergenic
1127344645 15:58082204-58082226 GTTCCTTTGCTTTTTAAATGTGG + Intronic
1127525473 15:59788149-59788171 GTGCATGTGCTTGTGATATGAGG - Intergenic
1128175196 15:65549034-65549056 GTGCCTTTGCTTATGAAAGGAGG - Intronic
1128717869 15:69921884-69921906 GTGCCTGAGCTGATCAGCTGAGG + Intergenic
1129574253 15:76723814-76723836 GTGCCTCTGCACATGAGATGGGG + Intronic
1131586961 15:93705670-93705692 TTGCTTCTGCTTACTAGATGTGG - Intergenic
1132721795 16:1320226-1320248 GTGCCTGTCCATCTTAGAGGAGG + Exonic
1133918754 16:10133045-10133067 GTGACTGTACTTATAAGAGGCGG - Intronic
1139512433 16:67435249-67435271 GTGCCTGTGCCTGTGAGCTGTGG + Intronic
1144092321 17:11869063-11869085 CTACCAGTGCTCATTAGATGAGG - Intronic
1148667511 17:49385906-49385928 GTGCCTGTGCTTGCTAAATTAGG + Intronic
1148753084 17:49957126-49957148 GTCCCTGTGCTTAGAAGCTGAGG + Intergenic
1151298175 17:73201203-73201225 GTGGATGTGCTTATTTGAAGGGG - Exonic
1152210762 17:79001853-79001875 GTGCCTGTGGGTATCGGATGAGG - Intronic
1155547046 18:26926813-26926835 GTGTCTGTACATATTAAATGTGG + Intronic
1158035960 18:53030630-53030652 GTGCCTTTGCTTTCTAGTTGAGG + Intronic
1163090215 19:15014092-15014114 ATGGCTTTGCTTATTAGGTGAGG - Intronic
926047667 2:9721761-9721783 GTCCCTGTCCTTGTAAGATGGGG - Intergenic
927174305 2:20394740-20394762 GTGCCTGTGCAGATTGGTTGTGG - Intergenic
929877180 2:45806590-45806612 TTGCCTGTGCTTATGAGGAGAGG - Intronic
933702594 2:85266362-85266384 GTGCCTGTGGTAATTAAAGGGGG + Intronic
940606735 2:155934068-155934090 ATGCTTGTGGATATTAGATGAGG - Intergenic
941826286 2:169900663-169900685 TTAGCTGTGCTTATTACATGTGG + Intronic
943794559 2:191976169-191976191 GTGCCTCTGCCTATTAGTTATGG + Intronic
1169687329 20:8289887-8289909 GTGCCAGTGCCTAATAGAGGTGG + Intronic
1170529419 20:17275446-17275468 TTACCTGTGCTTATTACATGGGG + Intronic
1174879483 20:54263284-54263306 ATGTATGTGCTTAGTAGATGAGG + Intergenic
1177462152 21:21426615-21426637 GTGGCTGTGATTATTAGCTGAGG - Intronic
950631139 3:14282964-14282986 GTGCCTGTTCACATTAGGTGAGG - Intergenic
953397353 3:42583698-42583720 GTGCCTGCGCATATTAGATGAGG - Intronic
954312483 3:49780966-49780988 GCGCCTGTACGTAGTAGATGAGG - Intronic
954709950 3:52500618-52500640 GTGCCTGTGCCCATGAGTTGAGG + Intronic
955066559 3:55538223-55538245 TGGGCTGTGCTTATTAAATGTGG + Intronic
955428116 3:58813718-58813740 GTGACTGTGATTATCAGATGGGG - Intronic
963779334 3:149471633-149471655 GCTCCTGTGCTTGTTAGCTGAGG + Intergenic
964543150 3:157802410-157802432 GTGTCTTTGCATATGAGATGGGG + Intergenic
966539116 3:181069592-181069614 GTTCCTGTGTTTATTTGCTGAGG + Intergenic
970591743 4:17565887-17565909 GTGCCTGTCCTCCTTAGATGGGG + Intergenic
971026810 4:22597226-22597248 GTGTCTGTACATATTAAATGGGG + Intergenic
974140222 4:57877089-57877111 CAGCCTGTGCTTGTCAGATGTGG - Intergenic
976166093 4:82256676-82256698 GTACCTGTGATCATTAGAGGTGG - Intergenic
976621636 4:87134460-87134482 GTGCCTGTGCTTCTGGGAGGTGG - Exonic
977901094 4:102423203-102423225 GTGCTTGTTCTTATCAAATGTGG - Intronic
979522926 4:121688983-121689005 GTATCTGTGCTCCTTAGATGGGG - Intronic
979813213 4:125065236-125065258 GTGTCTGTGCATATTACCTGGGG + Intergenic
981672289 4:147300709-147300731 TTGCTTGTGCTTTTGAGATGGGG + Intergenic
984687893 4:182691839-182691861 GTACTGGTGCTTATTTGATGTGG - Intronic
985316731 4:188665954-188665976 CTGCCTGTGGGTATTAAATGGGG + Intergenic
989515974 5:42343805-42343827 TTGCCTGTGCTTTTGAGATCTGG - Intergenic
990049666 5:51482190-51482212 GTTCCTGTGCTACTTTGATGAGG + Intergenic
997456247 5:134019722-134019744 GTGCATGTGCGTATGTGATGGGG - Intergenic
997878377 5:137569029-137569051 CTGCCTGTCCTTTTTACATGTGG + Intronic
998309166 5:141109600-141109622 GTTCCTGTGCTACTCAGATGTGG + Intronic
1001748233 5:174108392-174108414 GTGCCTGTGCTTATCGCTTGTGG - Exonic
1003887035 6:10531128-10531150 GTGCATTTGCTTACTAGCTGTGG - Intronic
1005223195 6:23611962-23611984 CTGCCTGGGCTTAGCAGATGGGG - Intergenic
1012291959 6:97467301-97467323 GTGCCTGTGCTATTGAGAGGCGG + Intergenic
1013661977 6:112307365-112307387 ATGGCTGTGCTTATGAAATGTGG + Intergenic
1013703175 6:112798537-112798559 GTGCCTGTTGTTCTTATATGGGG - Intergenic
1014921461 6:127218611-127218633 GAGCCTGACCTAATTAGATGAGG - Intergenic
1015759605 6:136644468-136644490 GTGCTTGTGCTGATTAAATTAGG - Intronic
1017212312 6:151870654-151870676 TTGCTTGTGATGATTAGATGAGG + Intronic
1023352619 7:39335440-39335462 GTGGCTGTGCTTGTGAGAAGAGG - Intronic
1030169443 7:106586774-106586796 GTGACAGTGTTTATAAGATGTGG + Intergenic
1032189245 7:129754045-129754067 GGGCCTGTGCTTCCTAGATGCGG + Intronic
1032710978 7:134459677-134459699 GTGTCTGTGCATACTAGGTGTGG + Intergenic
1037100786 8:15042865-15042887 GTGGCTTTGCTTATCACATGGGG + Intronic
1040370587 8:46768556-46768578 GTGCTCGTGCTTATTGAATGGGG - Intergenic
1042348042 8:67747666-67747688 GTGCCTATGCTTATTTAATAGGG - Intergenic
1050052143 9:1613848-1613870 GTGGCTGTGCCCTTTAGATGGGG + Intergenic
1051335918 9:16065836-16065858 GTGTGTGTGCTGATTAAATGAGG + Intergenic
1051348698 9:16177701-16177723 GTTCCTGTGCTTTTTAGGAGAGG - Intergenic
1053295065 9:36906781-36906803 CTGCCTGGGCTTCTTACATGCGG - Intronic
1053366317 9:37524926-37524948 GTGGCTGTGCTTCTTACAGGAGG - Intronic
1054936736 9:70696217-70696239 TAGCCTGTACTTTTTAGATGGGG + Intronic
1055631784 9:78232226-78232248 GTTACTGTTCTTATAAGATGAGG - Intergenic
1056125955 9:83537147-83537169 GTGCGTGTGCATATTTGCTGTGG - Intronic
1059113016 9:111574717-111574739 GTGCATGTGCTCATTACCTGGGG + Exonic
1061960880 9:133988479-133988501 CTGCCTGTGTTTAATAGGTGAGG - Intronic
1185689647 X:2143509-2143531 GAGGCTGTGCTAATTAGAAGAGG + Intergenic
1186800924 X:13092001-13092023 GTGCCTGAGCTTATAAGGAGTGG + Intergenic
1187406086 X:19005520-19005542 GTGCATTTGCTTATTAGAAGAGG + Intronic
1188458226 X:30391878-30391900 ATGGATGTGCTTATTAAATGAGG - Intergenic
1188696303 X:33195924-33195946 TAGCCTGTGCTTATTATATGTGG - Intronic
1189063725 X:37783480-37783502 GTGCCAGTGCTGACTAGAAGAGG - Exonic
1190931251 X:54951146-54951168 GTGCCTGGGCTTATTAGCACAGG - Intronic
1191800242 X:65071414-65071436 CTGCCTGTGCCTTTTAGTTGGGG + Intergenic
1200833729 Y:7712521-7712543 CTGCCTCTGTTTTTTAGATGAGG - Intergenic