ID: 1102198809

View in Genome Browser
Species Human (GRCh38)
Location 12:111043478-111043500
Sequence GCCACCTGCCAATGAGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102198804_1102198809 27 Left 1102198804 12:111043428-111043450 CCGGGAGAAGATTCTGAGCAGGT 0: 1
1: 0
2: 5
3: 19
4: 211
Right 1102198809 12:111043478-111043500 GCCACCTGCCAATGAGGAGTAGG 0: 1
1: 0
2: 0
3: 8
4: 148
1102198807_1102198809 -3 Left 1102198807 12:111043458-111043480 CCTGTCTCATTCTCACTTTTGCC 0: 1
1: 0
2: 3
3: 44
4: 380
Right 1102198809 12:111043478-111043500 GCCACCTGCCAATGAGGAGTAGG 0: 1
1: 0
2: 0
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102198809 Original CRISPR GCCACCTGCCAATGAGGAGT AGG Intronic
900410454 1:2510278-2510300 GCCACCTGCTGCTGAGGAGCAGG + Intronic
901080620 1:6581790-6581812 GCCACCTTCCTGAGAGGAGTGGG + Intronic
904321002 1:29697768-29697790 CCCACATTCCAATGAGGAGCTGG + Intergenic
910283632 1:85529502-85529524 CCCACCTGCCACTGAGGAAGGGG - Intronic
910929215 1:92425894-92425916 CCCAGCTGCCACTGAGGAGCAGG + Intergenic
912301945 1:108526814-108526836 GCCACCTGCCAATCAGGCATTGG + Intergenic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
914206383 1:145533488-145533510 CCCACCTGCCACTGAGGAAGGGG + Intergenic
916004492 1:160646941-160646963 TCCATCAGCCAATGAGGAGAAGG + Exonic
918250525 1:182699432-182699454 GCCCCCTGCCACTGAGGCCTGGG - Intergenic
919864110 1:201766381-201766403 GCCACATGGGGATGAGGAGTAGG + Intronic
922219012 1:223543667-223543689 GCCACCTTCCAATGAAGGGATGG - Intronic
924163223 1:241255355-241255377 TACACCTGTCAATGATGAGTTGG - Intronic
924462378 1:244270835-244270857 GCCACCTGCCAACCAGGAAGGGG + Intergenic
1065327295 10:24560322-24560344 GCCACTTGCAAATGAGGAATGGG - Intergenic
1067931586 10:50567541-50567563 GCCACCTGGCAACGAGGAACAGG + Intronic
1069192163 10:65505350-65505372 GCAACCTGCCAATGAGTAGCTGG + Intergenic
1073456789 10:103641729-103641751 ACCACCTCTCCATGAGGAGTGGG - Intronic
1073795225 10:106980030-106980052 ACCAACTGCCAATGTGGACTTGG - Intronic
1074107681 10:110400586-110400608 GCTTCCTTGCAATGAGGAGTAGG - Intergenic
1074914340 10:117941039-117941061 GCCACCTGCAAATAAGGAAGCGG + Intergenic
1075089181 10:119433710-119433732 GCCACCTCCCTATGTGGAGAAGG + Intronic
1077444089 11:2582288-2582310 TCCACCAGCCACTGAGGAGGAGG - Intronic
1084009319 11:66338842-66338864 CCCACCTGACATTCAGGAGTGGG + Intronic
1084243638 11:67840263-67840285 GCCACCTGCAAATAAGGTGGGGG - Intergenic
1085122432 11:73975667-73975689 GTCATCTGCCAAGGAGGAGCAGG + Exonic
1092210199 12:6640805-6640827 GGCACTTGGCAATGAGGATTTGG - Intronic
1096080452 12:48829084-48829106 GACACCTGGGCATGAGGAGTGGG - Intergenic
1097524119 12:60708950-60708972 GCCATATGCCAAAAAGGAGTGGG - Intergenic
1102198809 12:111043478-111043500 GCCACCTGCCAATGAGGAGTAGG + Intronic
1103566726 12:121819840-121819862 GCCCCCTGCCAAGGAGGTGGAGG + Exonic
1103919169 12:124390556-124390578 GACACCTGCCGATGAGCAGTGGG - Intronic
1105718952 13:23094913-23094935 CCCTCCAGCCAATGAGAAGTAGG + Intergenic
1109329698 13:60913621-60913643 GCCACGTAGCAGTGAGGAGTGGG + Intergenic
1112503227 13:99957697-99957719 TCCAGCTGCCAATGGGGCGTAGG + Intergenic
1113494463 13:110715777-110715799 GCCTCCAGCCAATGGGGAGGAGG - Exonic
1115692638 14:35860701-35860723 GGGAACTGCCAAAGAGGAGTTGG + Intronic
1116523341 14:45875166-45875188 ACCACCTGCTTATAAGGAGTGGG - Intergenic
1117991121 14:61435042-61435064 GCCATCAGCCAGTGAGGAATGGG + Intronic
1118393495 14:65316178-65316200 GCCACATGGCAATGAACAGTAGG + Intergenic
1121113504 14:91328391-91328413 GGCACCTGGCGAGGAGGAGTGGG + Intronic
1122323417 14:100868678-100868700 GAGCCCTGCCAGTGAGGAGTGGG - Intergenic
1122772746 14:104104556-104104578 GCCCCCAGCCCATGAGGGGTGGG - Intronic
1123011280 14:105350690-105350712 GCCACCAGCCAGTGAGGCGAAGG - Intronic
1126649583 15:50908042-50908064 GCGACCTGCTGAGGAGGAGTCGG + Intergenic
1127873358 15:63091239-63091261 GTCATCTGCCAGTGAGGAGCTGG - Intergenic
1128391756 15:67187141-67187163 GGCACCTCCCAGTGAGGAGATGG + Intronic
1135576534 16:23590231-23590253 GCCACATGCCAATCTAGAGTGGG + Intronic
1135965267 16:27030110-27030132 GCCAACTGCCATTGAGGACCTGG + Intergenic
1136302036 16:29341738-29341760 GCCTCCTGCAAATGAGAAGCAGG + Intergenic
1136371626 16:29840366-29840388 GCCATCTGCCAAAGTGGAGGTGG + Exonic
1136568634 16:31084200-31084222 GCTCCCTGCCTATGAGGACTGGG - Exonic
1137808000 16:51325734-51325756 GCCACCTGACAGTGAGGTATGGG + Intergenic
1138543580 16:57703230-57703252 GCCACCAGCCACTGAACAGTTGG - Intronic
1138598216 16:58040741-58040763 GTCCCTGGCCAATGAGGAGTAGG + Intronic
1138943399 16:61817645-61817667 GCCCCCTGCCACTGAAGCGTGGG + Exonic
1139670794 16:68491459-68491481 GATCCCTGCCAAGGAGGAGTTGG + Intergenic
1142601463 17:1054889-1054911 CCCACCTGCCAGTGAAGAGCAGG + Intronic
1143691804 17:8573901-8573923 GCCAAGTGCCAATGAGGATATGG + Intronic
1144796071 17:17892137-17892159 GGCACCTGTGAATGAGGAGGAGG + Intronic
1148460940 17:47838692-47838714 GCCCCCTGCCAAGGAGTAGAGGG + Exonic
1151444748 17:74155949-74155971 GCCATCTGCCAAGGAGGACAAGG + Intergenic
1153236224 18:2990986-2991008 GCCACATGCCAATGATGCCTGGG + Intronic
1157110210 18:44813552-44813574 GCCATCTGCAAATGAGAAGCTGG + Intronic
1159035809 18:63276058-63276080 GCCTCCCTCTAATGAGGAGTAGG - Intronic
1161645453 19:5450788-5450810 GGCATCTGCAAATGAGGACTGGG - Intergenic
1163148944 19:15399950-15399972 GACACCAGCCACTGAGGACTTGG + Intronic
1164623376 19:29710920-29710942 GCCACCTGGAAATGGGGAGACGG + Intronic
1164800636 19:31073428-31073450 GCCCCCTGCCAATGGGAAGAAGG + Intergenic
1165420693 19:35720685-35720707 GCCTCCTGCCCAAGAGGAGCAGG + Exonic
925645867 2:6036469-6036491 GTCAGCTGCTTATGAGGAGTAGG - Intergenic
932410611 2:71545129-71545151 GCCACCGGCACGTGAGGAGTAGG + Intronic
933180609 2:79222456-79222478 GCCACGTGGCAGTGAGGAGCAGG + Intronic
934123059 2:88858323-88858345 GCCACCTGCCTAAGAGGAAGTGG + Intergenic
935934517 2:108167246-108167268 GGCACCCACCAATGAGGAGGTGG + Intergenic
943290911 2:186070368-186070390 GCCTCCTGCCAAGGAAGAGGTGG - Intergenic
947317913 2:228882054-228882076 GCAATCTGCCAATGAGGAAGTGG + Intronic
947333494 2:229055264-229055286 GTCAGCTGCCCATGAGGAGAAGG - Intronic
1169546986 20:6660510-6660532 GCCACCTGCCAATGCTGAGGGGG - Intergenic
1172185207 20:33027275-33027297 CCCACCTGCCTATGAGGATGGGG - Intergenic
1172409785 20:34712289-34712311 CCCAGCTGGCAGTGAGGAGTAGG - Exonic
1173661533 20:44737713-44737735 GGTACCCACCAATGAGGAGTGGG - Intergenic
1174692100 20:52516231-52516253 GCCCCATGCCTTTGAGGAGTGGG + Intergenic
1175210831 20:57353357-57353379 GCCTCTTGCCACTCAGGAGTTGG - Intronic
1175575369 20:60056968-60056990 GCCATCTTCCAATCAGGAGGAGG - Intronic
1182466763 22:30521633-30521655 CCCATTTGCCAATGAGGAGATGG + Intergenic
1183750912 22:39719777-39719799 GCCACCTGCCAGTCAGTAGGTGG - Intergenic
1184743492 22:46442765-46442787 GCAACCTGGTAATGAAGAGTGGG - Intronic
1185164970 22:49255808-49255830 GCCGCCTGCTGAAGAGGAGTGGG + Intergenic
950453254 3:13077672-13077694 GCCACCTGCACGTGAGGGGTGGG - Intergenic
950707931 3:14794447-14794469 GCCCCCTTCCTGTGAGGAGTTGG - Intergenic
952584058 3:34869954-34869976 GCCACCTGTCACATAGGAGTAGG + Intergenic
954387016 3:50249405-50249427 TCCACCTGCCAATGAGGACATGG - Intronic
957059221 3:75468248-75468270 GCCACCTGCAAATAAGGTGGGGG - Intergenic
957645687 3:82921868-82921890 GCCCCTTGCCAAAGATGAGTTGG + Intergenic
958906724 3:99950036-99950058 GCTACCTGCTAAGGAGGATTGGG + Intronic
959746832 3:109785426-109785448 GCCATCTGCTAATGACTAGTAGG + Intergenic
961294235 3:125871476-125871498 GCCACCTGCAAATAAGGTGGGGG + Intergenic
961891733 3:130135992-130136014 GCCACCTGCAAATAAGGTGGGGG - Intergenic
962124432 3:132600827-132600849 GTCCCCAGCCAATCAGGAGTGGG + Exonic
963722866 3:148883794-148883816 GCCACCTAACCATGAGGACTTGG + Exonic
963899446 3:150720066-150720088 GCCACATGCCAATGATGCCTGGG - Intergenic
968809084 4:2792165-2792187 GACTCCTCCCCATGAGGAGTGGG - Intergenic
968834851 4:2955598-2955620 GCCTCCTGGCAATGAGGGGAAGG + Intronic
969750900 4:9110097-9110119 GCCACCTGCAAATAAGGTGGGGG + Intergenic
972636971 4:40893065-40893087 GCCAGATGCCAGTGAGGACTGGG - Intronic
976511270 4:85911770-85911792 GCCACCTGCAAATGATTATTGGG + Intronic
979931007 4:126630567-126630589 ACTACCTGCCAAGGAGGAGCAGG - Intergenic
981574457 4:146190212-146190234 GCCACTTGCACATAAGGAGTGGG + Intronic
984702677 4:182828219-182828241 GACACCTGCCAAGGAGAAGGAGG - Intergenic
985723158 5:1501297-1501319 GCCCCCTGCCAGTGGGGACTCGG - Intronic
986043107 5:4012125-4012147 GCCACCTGCCCAGGAGAACTGGG + Intergenic
991246271 5:64511574-64511596 TCCACGTGCCTATCAGGAGTAGG + Intronic
997531971 5:134587026-134587048 GCAACCTGGAAATGAGGGGTTGG - Intergenic
999271958 5:150302058-150302080 CCTACCTGCCAGTGAGGAGCTGG + Exonic
999322920 5:150625868-150625890 GCCACCTGCCATTCAGGACAGGG - Intronic
1001082381 5:168676869-168676891 GCCAGCTGCCAGGCAGGAGTAGG - Intronic
1001708562 5:173759929-173759951 GCCAGCAGCCGATGAGGAGCTGG - Intergenic
1003080553 6:3017611-3017633 GCCACCTGCCAAAGGGAAGGTGG + Intronic
1007683483 6:43650402-43650424 GCCCCCTGCCACAGAGGAGATGG + Exonic
1009274260 6:61654965-61654987 GGCTTCTGCCAATGAGGATTTGG - Intergenic
1012477419 6:99629630-99629652 GCCAGCTGGCAGTGAGGAGTGGG + Intergenic
1015979340 6:138823176-138823198 GTCCCCAGCCAATCAGGAGTGGG + Intronic
1016006239 6:139091883-139091905 TTCACCTTCCTATGAGGAGTTGG - Intergenic
1017384357 6:153866343-153866365 CCCACCTGCAAATGAGGAGATGG + Intergenic
1018810158 6:167293238-167293260 TCCACCAGCCCAGGAGGAGTGGG - Intronic
1019813800 7:3184529-3184551 GCCCCATGCCAGTGAGGAGAAGG + Intergenic
1020322073 7:6946542-6946564 GCCACCTGCAAATAAGGTGGGGG - Intergenic
1024376059 7:48639372-48639394 GGCACCAACCCATGAGGAGTGGG + Intronic
1024939346 7:54746030-54746052 GCCACCAGCACATGAAGAGTGGG + Intergenic
1032119208 7:129144638-129144660 GCCACGAGCCAATGGGAAGTCGG + Intergenic
1032267222 7:130378089-130378111 GGCACCAGGAAATGAGGAGTAGG + Intergenic
1033430241 7:141282436-141282458 GCCACCTGCCTATAATCAGTAGG + Intronic
1036374104 8:8185493-8185515 GCCACCTGCAAATAAGGTGGAGG + Intergenic
1036876799 8:12480146-12480168 GCCACCTGCAAATAAGGTGGAGG - Intergenic
1037377256 8:18244290-18244312 GCCACCTGCTACTCAGCAGTAGG + Intergenic
1039461102 8:37745108-37745130 GCCAGATGCCAATTAGTAGTGGG + Intronic
1041189705 8:55341336-55341358 GCCCTCTGCCAATGAAAAGTGGG - Intronic
1041456849 8:58070139-58070161 GCCACCAACCAATGAGGAAAAGG - Intronic
1041638403 8:60170143-60170165 GCAACCTGGCAATGAGCAGGGGG + Intergenic
1042604451 8:70531584-70531606 GCCAACTGCCTTTGAGTAGTTGG - Intergenic
1045245187 8:100436416-100436438 GCCCCCAGGCAATGAGCAGTTGG - Intergenic
1045665883 8:104483821-104483843 GGCACATGCCAGTAAGGAGTTGG + Intergenic
1045948865 8:107829259-107829281 GCCTCCTGAGAATGAGGAGATGG + Intergenic
1048994788 8:139787735-139787757 GCTACCTGCCAATGAGCACCTGG + Intronic
1056044195 9:82699910-82699932 GCCTCCTGCCTATGAGTAGCGGG - Intergenic
1056438573 9:86597351-86597373 GCCACCTGCAAACCAGGAGCAGG - Intergenic
1057558467 9:96108290-96108312 GCCTCCTTCCAGGGAGGAGTAGG - Exonic
1057811838 9:98263465-98263487 ACCACCTCCCTATGAGGACTGGG + Intergenic
1058823359 9:108753238-108753260 ACCACCTACCAGTGAGGTGTAGG - Intergenic
1058843751 9:108935045-108935067 GCCATCTGCCACTTAGAAGTAGG + Intronic
1060997381 9:127882863-127882885 GCCCCCTCCCAAGGAGGGGTGGG + Intergenic
1061195881 9:129106861-129106883 GTCACTTGCCAATGAGGTGGGGG - Intronic
1061955818 9:133960841-133960863 GGCACCAGCCAGTGTGGAGTAGG - Intronic
1190384180 X:49868472-49868494 GCCACCTGGAAATAAGGAGGGGG - Intergenic
1197136491 X:123066316-123066338 GGCAGCTGCCAATGGGGAGGAGG + Intergenic
1198303769 X:135359215-135359237 ACCAGCTGTCAATGAGGAGAGGG + Intronic