ID: 1102199632

View in Genome Browser
Species Human (GRCh38)
Location 12:111048433-111048455
Sequence CACAGCTCCCACCTTGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102199632_1102199640 17 Left 1102199632 12:111048433-111048455 CCCCCAGCAAGGTGGGAGCTGTG 0: 1
1: 0
2: 1
3: 30
4: 247
Right 1102199640 12:111048473-111048495 TGGCTGGTTTTCTGTGTGAGTGG 0: 1
1: 0
2: 2
3: 16
4: 295
1102199632_1102199638 1 Left 1102199632 12:111048433-111048455 CCCCCAGCAAGGTGGGAGCTGTG 0: 1
1: 0
2: 1
3: 30
4: 247
Right 1102199638 12:111048457-111048479 TTCCTTGGTAAGCGTATGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 55
1102199632_1102199642 30 Left 1102199632 12:111048433-111048455 CCCCCAGCAAGGTGGGAGCTGTG 0: 1
1: 0
2: 1
3: 30
4: 247
Right 1102199642 12:111048486-111048508 GTGTGAGTGGCCAGCTGGTGTGG 0: 1
1: 0
2: 0
3: 25
4: 275
1102199632_1102199641 25 Left 1102199632 12:111048433-111048455 CCCCCAGCAAGGTGGGAGCTGTG 0: 1
1: 0
2: 1
3: 30
4: 247
Right 1102199641 12:111048481-111048503 TTTCTGTGTGAGTGGCCAGCTGG 0: 1
1: 0
2: 2
3: 12
4: 207
1102199632_1102199637 -3 Left 1102199632 12:111048433-111048455 CCCCCAGCAAGGTGGGAGCTGTG 0: 1
1: 0
2: 1
3: 30
4: 247
Right 1102199637 12:111048453-111048475 GTGCTTCCTTGGTAAGCGTATGG 0: 1
1: 0
2: 1
3: 1
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102199632 Original CRISPR CACAGCTCCCACCTTGCTGG GGG (reversed) Intronic
900384267 1:2402392-2402414 CACAGCTCCCCCAATGCTGCGGG - Intronic
901041744 1:6368329-6368351 CACCGCACCCACCCTGCTGATGG - Intronic
901068711 1:6506755-6506777 CACAGCTCCTGCCCTGCTGGGGG - Intronic
901210852 1:7525234-7525256 CACTGCTCCCACCCTGCTGCAGG - Intronic
903366159 1:22806643-22806665 CACAGCTAACACCTGCCTGGCGG - Intronic
904493694 1:30875318-30875340 CACAGGGCCCAGGTTGCTGGAGG - Intronic
905181449 1:36169618-36169640 CACAGCTACCAACTTGCTTAGGG - Intronic
905581327 1:39084450-39084472 CACAGCGTCCAGCCTGCTGGGGG - Intronic
907053411 1:51344781-51344803 CCCAGTTCCCGCCCTGCTGGGGG + Intronic
907291231 1:53414153-53414175 CACAGCTCCCAACTTTTTGCAGG + Intergenic
912799298 1:112711187-112711209 TCCAGCTTCCACCTTGCTGCGGG + Intronic
914392807 1:147237163-147237185 CTCAGCTCCAACCTTGCTCTGGG + Intronic
916037538 1:160934305-160934327 AACAGCTCCTGCCTTGCTGCTGG + Intergenic
919092346 1:192991057-192991079 CACAACTCCCATCTTGAAGGGGG + Intergenic
919858290 1:201720397-201720419 CACAGCTCCCAGATTGATGGAGG + Intronic
920215129 1:204357607-204357629 CACAGCTCCAACCTTCCTCTGGG + Intronic
920286708 1:204884817-204884839 CATAGCACCCAGCATGCTGGTGG - Intronic
922877824 1:228954252-228954274 CAGAGCTCCCAACATGGTGGCGG - Intergenic
922934009 1:229410141-229410163 CACAGCCCTCTCCTTTCTGGAGG - Intergenic
923138591 1:231140839-231140861 CACATCACCCACCTGGCTGCTGG - Intergenic
923777619 1:236994325-236994347 CTCAGCTCCCAGAATGCTGGTGG - Intergenic
924616129 1:245613473-245613495 CACACCTCCCAGCTAGTTGGGGG + Intronic
1063543986 10:6962215-6962237 GTCAGTTCCCACCTGGCTGGAGG - Intergenic
1063680727 10:8185050-8185072 CACAGCCCCCAGCTTGCAGGAGG - Intergenic
1064170547 10:13028340-13028362 CACAGTTCCCACGTGGCTGGGGG - Intronic
1067566050 10:47338396-47338418 CAGAACTCACACATTGCTGGTGG + Intergenic
1068860361 10:61841539-61841561 CCCAGCTCCCACCCCTCTGGTGG - Intergenic
1069756065 10:70775080-70775102 CTCAGCTCCCACCCTGGAGGGGG - Intronic
1069908462 10:71745973-71745995 CTCAGGACCAACCTTGCTGGAGG + Intronic
1070327194 10:75396759-75396781 CAGAGCTCCCAACTAGCCGGAGG + Intergenic
1071515520 10:86294323-86294345 AACAGCTCCCATCTCGCTAGAGG - Intronic
1072675937 10:97466144-97466166 CAGTGCTGCCACCCTGCTGGAGG + Exonic
1073188313 10:101630854-101630876 CAAACATCCCACCTTGCAGGTGG + Intronic
1073426003 10:103455964-103455986 TAAAGCACCCACCGTGCTGGCGG + Intronic
1075394264 10:122115238-122115260 CACAGCCCCCACCTTCAAGGAGG + Intronic
1075742032 10:124701791-124701813 CACAGGGCCCACCTGCCTGGGGG - Intronic
1075745212 10:124722790-124722812 CACGTCTCCCTCCTTCCTGGGGG - Intronic
1076297118 10:129394850-129394872 CTCGGCTCCCACCTTGCCCGAGG + Intergenic
1076518928 10:131067724-131067746 CACACCTCCCACCTCACTGCTGG - Intergenic
1077165155 11:1131449-1131471 CACCGCTGCCCCCTTACTGGGGG - Intergenic
1077216993 11:1399076-1399098 CCCAGCTCCTTCCTGGCTGGAGG - Intronic
1077219334 11:1408451-1408473 CACAGCGGCCACCAGGCTGGGGG + Intronic
1077317757 11:1926963-1926985 CCCACCTCCCACCTTCCTGTTGG - Intronic
1077510697 11:2960301-2960323 CCCAGCCCCCACCCTGCTGGGGG + Intronic
1078740307 11:14059921-14059943 CAAAGCTTCCCCCTTGCAGGTGG + Intronic
1079347646 11:19667093-19667115 CACAGCTAGCAGCTTCCTGGGGG - Intronic
1079956509 11:26873056-26873078 CACTGCACCCAGCTTGCTGTGGG - Intergenic
1081164111 11:39786656-39786678 CACTGCACCCACCTGGCTGATGG - Intergenic
1083350609 11:62026013-62026035 GACAGCCCCCACCTTGCTCACGG + Intergenic
1083768227 11:64852494-64852516 CTCAGCTCCCACCTTGCTCAGGG + Exonic
1084218548 11:67664545-67664567 CGCAGCCCCCACGGTGCTGGTGG - Exonic
1086724602 11:90167165-90167187 CACAGCTCCCAGCAAGCTGAGGG - Intronic
1088895091 11:114072479-114072501 CACAGATACCACCTTACTGATGG + Intronic
1090432540 11:126658039-126658061 CACAGCTCTCCCATTTCTGGAGG + Intronic
1090551053 11:127820407-127820429 CACAGCAGGCACCTTGCTAGTGG + Intergenic
1091332070 11:134737699-134737721 CCCAGGTCCCACCTTGGAGGAGG + Intergenic
1091662090 12:2391904-2391926 CTCAGCTGCCACGTGGCTGGTGG + Intronic
1091944336 12:4522101-4522123 CAAAGGTACCATCTTGCTGGGGG + Intronic
1095414457 12:41961075-41961097 CACAGTAGCCACATTGCTGGGGG - Intergenic
1096177536 12:49532911-49532933 CACAGGGCTCACCATGCTGGAGG - Intergenic
1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG + Intronic
1100270790 12:93022750-93022772 CAAAGCTCACGCCTTGCTGATGG + Intergenic
1100360179 12:93870572-93870594 CAGAGCTTCCACCCTACTGGTGG - Intronic
1101898088 12:108770505-108770527 CTCATCTCCCAGCTAGCTGGAGG - Intergenic
1102199632 12:111048433-111048455 CACAGCTCCCACCTTGCTGGGGG - Intronic
1103081398 12:118026825-118026847 CACAGCTGCCACCAAGCTGCAGG - Intronic
1104018746 12:124977548-124977570 GTCAGCTGCCACCTTCCTGGAGG - Intronic
1104946207 12:132415885-132415907 CACGGCTCCCACCCCACTGGAGG + Intergenic
1105213512 13:18271578-18271600 CACAGCCCAGACCTTTCTGGGGG + Intergenic
1107015679 13:35706392-35706414 CACAGCTCCCAGCAGGCTGCAGG + Intergenic
1107940374 13:45377283-45377305 CTCAGTCCCCGCCTTGCTGGGGG + Intergenic
1108035900 13:46290528-46290550 TGCAGCTCCCACCATCCTGGTGG - Intergenic
1108053191 13:46464586-46464608 CTCAGTCCCCACCTCGCTGGGGG - Intergenic
1110891595 13:80704538-80704560 CTCAGTTCCCGCCTTGCGGGCGG - Intergenic
1111980390 13:95009279-95009301 CACAGCTCCCTCCAAGCTGAAGG - Intergenic
1112267440 13:97937815-97937837 CACTTCTCACACATTGCTGGTGG + Intergenic
1113344793 13:109466825-109466847 CACAGCTCCCACAAGGCTGCTGG + Intergenic
1113432435 13:110262266-110262288 CTCAGCCCCCCACTTGCTGGCGG - Intronic
1115505124 14:34086485-34086507 CAGAGCTCCTATATTGCTGGGGG + Intronic
1115645294 14:35365189-35365211 GACAGCTCCCACCTTCTTAGAGG + Intergenic
1119288441 14:73475116-73475138 CACAACCCCCACTTTGCTGTTGG + Intergenic
1121773077 14:96569194-96569216 CACATTTCCCACCTTACTGGTGG - Intergenic
1122396782 14:101439097-101439119 CTCAGCTTTTACCTTGCTGGAGG + Intergenic
1122441413 14:101734653-101734675 CACAGCTGCACCCCTGCTGGAGG - Intergenic
1122628993 14:103098939-103098961 CCCAGCAGGCACCTTGCTGGAGG + Intergenic
1126489956 15:49225820-49225842 CACAGCACCAACTGTGCTGGGGG + Intronic
1127383139 15:58446683-58446705 CACACCTCTCTCCCTGCTGGAGG + Intronic
1127582737 15:60352371-60352393 CACAGTGCCCACCTTTCTGGAGG + Exonic
1128667332 15:69548076-69548098 CACAGCTCCCCCATTCCTGGTGG - Intergenic
1129169177 15:73797509-73797531 CCCAGCTGCCACCCTGCTGTGGG + Intergenic
1129182621 15:73886749-73886771 CCCTGCTCCCACCTTGCTGGAGG + Intronic
1129884707 15:79030174-79030196 CACAGCTCCCAGCTGGGTGGAGG - Intronic
1130578866 15:85117136-85117158 CTCAACACCCACCTTTCTGGAGG - Intronic
1130620241 15:85454182-85454204 CTAACCTCCCACCCTGCTGGAGG + Intronic
1131074035 15:89483772-89483794 CCCAGCTCCCTCCTTCCTGCAGG - Intronic
1135429869 16:22374219-22374241 CCCCGCCCTCACCTTGCTGGAGG + Exonic
1135964771 16:27026739-27026761 CACAGCTCCCAACTTCATGAAGG + Intergenic
1136097181 16:27965554-27965576 CAGAGCTTGCAGCTTGCTGGGGG - Intronic
1136420832 16:30131824-30131846 CACTCCTCCCAGCTTGCTTGTGG - Intergenic
1139026567 16:62824985-62825007 AACAGCTCCCACCCTGATGCTGG - Intergenic
1139711304 16:68778586-68778608 CACAGCTCCCTACCTGCTGAAGG + Intronic
1141166849 16:81666677-81666699 CCCAGATCCCACCTTGCTCTTGG + Intronic
1141825703 16:86478329-86478351 CACAGCTGCCACCAAGATGGAGG + Intergenic
1142146731 16:88495917-88495939 CCCAGCTCCCACCTCACAGGCGG - Intronic
1142187793 16:88702643-88702665 CAGAGCCACCACCTGGCTGGTGG + Intronic
1142227371 16:88884208-88884230 CCCAGCCCCCACCTTGCGGAGGG - Intronic
1142308023 16:89296376-89296398 CACAGCTCCCCGCTTCCTGCAGG + Intronic
1143597491 17:7923956-7923978 CCCAGATCTCACCTTGATGGAGG + Exonic
1144670289 17:17128998-17129020 CCCAGCTCCCAGCTGCCTGGTGG - Intronic
1144831392 17:18133215-18133237 CACAGTTCCCACCCTGCATGAGG - Exonic
1145207252 17:20991154-20991176 CACAGCTCCCACCATGCCCCTGG - Intergenic
1145865881 17:28241263-28241285 GACGGCTGCCAGCTTGCTGGAGG + Intergenic
1145883850 17:28369569-28369591 CACAGCTCCTCCTCTGCTGGGGG + Exonic
1145911247 17:28544556-28544578 CTCTGCTCCCACCTCCCTGGAGG + Intronic
1148676118 17:49445962-49445984 CACAGCACCCACAGTGCTGCGGG + Intronic
1149085926 17:52716005-52716027 CACAGTTCCCACATTGCTGTAGG + Intergenic
1149663112 17:58346372-58346394 CTCAGCTGCCACCTTGAGGGGGG + Intronic
1150127957 17:62650776-62650798 CACAGGTCCCAGTTTGCCGGGGG + Intronic
1151122505 17:71808512-71808534 GACAGCCCCCACCTTCCTGTTGG + Intergenic
1151446097 17:74165063-74165085 CACTTCTCCCAAATTGCTGGAGG - Intergenic
1151518779 17:74613977-74613999 CACACCTCCCATCTTCCTGGTGG - Exonic
1151582701 17:74989067-74989089 CACACCCCCCAGCTTGCTGGAGG - Intronic
1152476466 17:80521582-80521604 CCCAGCTCCCAGCTGGCTGTTGG - Intergenic
1152538053 17:80961657-80961679 CACAGCTGCTCCCCTGCTGGGGG + Intronic
1152938612 17:83154304-83154326 CACAGCCCCCACTTTACTTGGGG - Intergenic
1153289389 18:3485510-3485532 CACTGCTCCCACCTTCCTCACGG + Intergenic
1153955610 18:10093180-10093202 GACATCTCTCACCTTTCTGGAGG - Intergenic
1154391324 18:13938899-13938921 CACAGCTCCCGCCCAGCTTGAGG + Intergenic
1157433625 18:47651083-47651105 CACACCTCCCACCTGCCTGTGGG - Intergenic
1159002816 18:62988435-62988457 CCCTGCACCAACCTTGCTGGAGG - Intergenic
1161274938 19:3410618-3410640 CATAGCTCCCACCTTCTTTGCGG - Intronic
1161277447 19:3426593-3426615 CACGGCTCCCACCTCTCTTGGGG + Intronic
1161493705 19:4576230-4576252 CATGGCTCCCACCTCCCTGGGGG + Intergenic
1162155806 19:8677388-8677410 CAGAGCTCAGACCCTGCTGGGGG + Intergenic
1162486393 19:10962936-10962958 CCCAGCTCTCACGGTGCTGGGGG - Intronic
1162833192 19:13299537-13299559 CATGGCTCCCACCTGGCTAGGGG + Intronic
1163120369 19:15213796-15213818 CACAGTTCCCAACATGGTGGGGG + Intergenic
1165454090 19:35900700-35900722 CCCAGCTCCCTCCTTCCCGGGGG - Intronic
1166818393 19:45560995-45561017 AACAGCTCCCTCCGTGGTGGGGG + Intronic
1167485148 19:49758401-49758423 CACAGCTGCCAGCTCGCTGTGGG - Intronic
1168713599 19:58514875-58514897 CACATCTGCCACCTTCCTGCAGG + Intronic
925109104 2:1318625-1318647 CCGCGTTCCCACCTTGCTGGTGG - Intronic
925609634 2:5692506-5692528 CGCAGCTCCCACCGCGCCGGCGG + Intergenic
925718059 2:6803087-6803109 CACCCCTTCCACCTGGCTGGTGG + Intergenic
926058672 2:9791881-9791903 AACAGCCCCCACCGTCCTGGAGG - Intergenic
926776599 2:16429586-16429608 GACATCTCCAACCCTGCTGGTGG + Intergenic
927702352 2:25276539-25276561 CGCAGCTCCCCTCATGCTGGGGG - Intronic
929444713 2:41992752-41992774 CACAGCTCTCAGCCTGGTGGTGG - Intergenic
930368891 2:50479261-50479283 CACTGCTCCATCCTTGCTTGTGG + Intronic
934512021 2:94953097-94953119 CACAGCTGCCTCCTTCCTCGAGG + Intergenic
936025915 2:109031218-109031240 CACTGCTGACACCTTGATGGTGG - Intergenic
936996860 2:118424802-118424824 CTCACCTCCCACCTTACTGTTGG - Intergenic
937260138 2:120580165-120580187 CTCAGCTCACACACTGCTGGAGG + Intergenic
937975647 2:127580839-127580861 CACAGCTTCCATTTTGGTGGGGG + Intronic
946185282 2:217977432-217977454 CCGAGCACACACCTTGCTGGAGG - Intronic
946366386 2:219251757-219251779 CACAGCTACCACCCTGGGGGAGG - Intronic
947637147 2:231685945-231685967 CACAGGGCCCACCTCACTGGGGG + Intergenic
947917803 2:233845507-233845529 CAGGGCTCCCACCTTCCTGATGG + Intronic
948970404 2:241421307-241421329 CAGATTTCCCACCTTGCTGGGGG - Intronic
1168761466 20:352977-352999 CCCAGCTCCCACCTAGCAGTGGG - Intronic
1169769363 20:9184409-9184431 CACAGTGTCCACCATGCTGGGGG - Intronic
1169855368 20:10096102-10096124 CACTGTTCCCACCTTGCTTTAGG - Intergenic
1171202043 20:23249947-23249969 CACAGCTCAGACACTGCTGGAGG - Intergenic
1171974770 20:31587643-31587665 CTCAGCTCCCACCGTCCTAGTGG + Intergenic
1172147211 20:32764897-32764919 CACAGGCCCCACGTGGCTGGAGG - Intronic
1172484286 20:35288947-35288969 CACAGCCACCACCTGGGTGGGGG + Exonic
1175330941 20:58163396-58163418 GACAGCACCCGCCTTGGTGGGGG + Intergenic
1176381006 21:6111906-6111928 CACACCTCCCACGGGGCTGGAGG + Intronic
1178390365 21:32192798-32192820 GACTGCTCCCACCTTGCAAGAGG - Intergenic
1179142752 21:38741325-38741347 AACAGCTCCCACCTTCCTCTTGG + Intergenic
1179742466 21:43426334-43426356 CACACCTCCCACGGGGCTGGAGG - Intronic
1180072974 21:45446999-45447021 CACAGCTGACACCGTGCTTGTGG + Intronic
1180105740 21:45617050-45617072 CCCAGCAGCCACCTTCCTGGAGG - Intergenic
1180816345 22:18791978-18792000 CACAGCCCAGACCTTTCTGGGGG + Intergenic
1181173395 22:21022778-21022800 CCCGGCCCCCACCCTGCTGGGGG - Intronic
1181202534 22:21226310-21226332 CACAGCCCAGACCTTTCTGGGGG + Intronic
1181733901 22:24867150-24867172 CACAGTCCCTACCTTGCTGGTGG - Exonic
1182011662 22:27006332-27006354 CCCAGCTCCCAACTCCCTGGGGG - Intergenic
1182034123 22:27184110-27184132 GACAGATTCCACCTTGATGGTGG - Intergenic
1182518486 22:30872061-30872083 CCCAGATCCCACAGTGCTGGGGG + Intronic
1182757346 22:32690684-32690706 CACAGCTCCCACCTGGTGGAGGG - Intronic
1183930895 22:41235519-41235541 CACCGCTCCCAAATTCCTGGTGG - Intronic
1183952457 22:41359150-41359172 CACAGCCCCCACCTTGGGTGTGG - Exonic
1184286156 22:43472805-43472827 CACAGGTCTCATCTAGCTGGGGG + Intronic
1184567254 22:45299419-45299441 CCCACCTCCCATCTTCCTGGGGG + Intergenic
1184759182 22:46535331-46535353 CACGGCCTCCACCTTTCTGGGGG - Exonic
1185065254 22:48628853-48628875 GACACCTTCCACCTTGCAGGAGG - Intronic
1185105030 22:48863868-48863890 CTGACCTCCCACCTGGCTGGTGG + Intergenic
1185266012 22:49904325-49904347 CCCAGCACCCACCTGTCTGGGGG + Exonic
1203224379 22_KI270731v1_random:69103-69125 CACAGCTCAGACCTTTCTGGGGG - Intergenic
1203266447 22_KI270734v1_random:17689-17711 CGCAGCTCAGACCTTTCTGGGGG + Intergenic
952788089 3:37176021-37176043 CCCTGCTCCCACCGGGCTGGCGG + Intronic
953421432 3:42756469-42756491 CCCAGCCCACACCTTGTTGGTGG + Intronic
953611429 3:44450604-44450626 CACAGCTCCCAGCTTTGAGGTGG + Intronic
954157466 3:48694490-48694512 CAAAGACCCCACCATGCTGGTGG + Intronic
954425571 3:50441130-50441152 CACATGTCCCTCCTTCCTGGAGG - Intronic
958183721 3:90091643-90091665 CACAGCACCCAGCTTTCTGTGGG + Intergenic
958498528 3:94875409-94875431 CACACCTCCCACATTGCAGCTGG + Intergenic
960268310 3:115646978-115647000 CATAGCACCCTCCTTGTTGGTGG - Intronic
961093938 3:124138810-124138832 GAGAGCTCCCAGCTTGTTGGAGG + Intronic
962334763 3:134517224-134517246 CTCAGCCCACACTTTGCTGGGGG + Intronic
963288754 3:143465067-143465089 CTCATCTCCCTCCTGGCTGGTGG + Intronic
966887754 3:184386272-184386294 CACAGCGCCCCCCCGGCTGGTGG + Intronic
967863372 3:194170242-194170264 CACCACTCCCACCTTCATGGTGG + Intergenic
968528600 4:1077871-1077893 CACAGCTCCCGTGTTGCCGGTGG + Intronic
968709744 4:2105158-2105180 CACACCACCCACCCTGCTGCTGG + Intronic
969414827 4:7051368-7051390 GGCAGCGCCCACCCTGCTGGAGG - Intronic
970326805 4:14934202-14934224 CCCAGCCCCCACATTGTTGGAGG - Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
978645986 4:110932191-110932213 CACTGCTCCCACCTTGGTCAAGG - Intergenic
979649764 4:123115388-123115410 CGCCGCACCCACCCTGCTGGCGG - Intronic
981532521 4:145765861-145765883 CCCAGCTCCCCCACTGCTGGGGG + Intronic
982081363 4:151793436-151793458 CACAGCTCCCAGAATGATGGTGG + Intergenic
989108708 5:37887047-37887069 CACAGCTGCCACCTTTCAGAGGG - Intergenic
991657005 5:68914073-68914095 CACAGCAACCACCTTGCTTGAGG + Intergenic
992111404 5:73498058-73498080 AGCAGCTCTCCCCTTGCTGGAGG - Intergenic
998266842 5:140673140-140673162 CACAGTTCCTCCTTTGCTGGGGG + Intronic
999743457 5:154574271-154574293 CACAGTTCTCACCGTTCTGGAGG + Intergenic
1001222656 5:169915396-169915418 CACTGCTCCCATTTTGCTGGTGG + Intronic
1003198943 6:3941113-3941135 CAGAGCTCCCAGCTTGCATGGGG + Intergenic
1003755872 6:9119230-9119252 CACAGCTACCACGTTTCTGAAGG + Intergenic
1006706358 6:36024547-36024569 CACGGCTCTCGCCTGGCTGGCGG + Exonic
1007004046 6:38343047-38343069 CACTGCTCCCACTTGGCTGAGGG + Intronic
1007223826 6:40299229-40299251 CATGGCTCCCACCTTGCCTGAGG - Intergenic
1007372503 6:41435573-41435595 CAAAACTCCCACATTGATGGGGG - Intergenic
1007547474 6:42705148-42705170 AGGAGCTCCCACCTGGCTGGGGG - Intronic
1011714733 6:90093295-90093317 CACATCTCCCCCCATGCTGTAGG - Intronic
1011782910 6:90810140-90810162 CAAAGATCCCACATTGTTGGAGG - Intergenic
1011984715 6:93428897-93428919 CACAGCTACCACCTTTCTTTTGG - Intergenic
1012437162 6:99226678-99226700 TACAGATCCTCCCTTGCTGGGGG - Intergenic
1012575196 6:100787097-100787119 CACAGGTCCCACTATGCTTGAGG - Intronic
1014919552 6:127197475-127197497 CACAGCCCACCCCTTGCAGGAGG + Intronic
1016678721 6:146803422-146803444 CACAGCCCCCACCTTCCAGGGGG + Intronic
1018885690 6:167934308-167934330 CACAGCACCAAACCTGCTGGGGG + Intronic
1018887939 6:167957146-167957168 CTCAGATGCCACCTTTCTGGGGG + Intronic
1019639746 7:2097062-2097084 CACATCTCCCGCCTTGCAGCTGG - Intronic
1020503411 7:8952650-8952672 AACAGCTCCCACCTAACTTGAGG - Intergenic
1023036330 7:36134466-36134488 CAGAGCTCAGACCTTGATGGTGG - Intergenic
1023243684 7:38178202-38178224 CACAGCTCGCATCTCGCTCGAGG - Exonic
1025032937 7:55572217-55572239 CGCGGCGCCCACCATGCTGGCGG - Intronic
1026306121 7:69143407-69143429 CAGGGCTCCCACATTGCTGTTGG + Intergenic
1029107443 7:98189829-98189851 CACAGCTGCCAGCGTGATGGGGG + Intronic
1029211852 7:98915878-98915900 CACTGCTCTGACCTTGCAGGAGG - Exonic
1029272961 7:99387930-99387952 TACAGCTTCCACCTGGATGGTGG + Intronic
1029858451 7:103543200-103543222 CACAGCCCCCACCTTCCTGATGG - Intronic
1032415367 7:131731613-131731635 GACACCTCCTGCCTTGCTGGTGG + Intergenic
1033258938 7:139825585-139825607 CACAGCTCCCACCCTGCTCATGG - Intronic
1034419827 7:150984050-150984072 CAAAGCTCCAACCTGGCTGGAGG - Intergenic
1035455336 7:159005328-159005350 CTCAGCTCAAACCCTGCTGGGGG - Intergenic
1035556224 8:569190-569212 CGCAGCGCCCGCCTTGCAGGAGG - Intergenic
1037863749 8:22426310-22426332 CTCAGCTCCCAATTAGCTGGGGG + Intronic
1048354799 8:133644492-133644514 CAAAACTCCCACCTTGGTGTGGG + Intergenic
1049388259 8:142355035-142355057 CAGAGGGCTCACCTTGCTGGGGG - Intronic
1049554480 8:143275203-143275225 CACAGCTCCAACCAGGCTGAGGG - Intronic
1049651595 8:143772233-143772255 CACGGCGCCCACCTTGCTGTTGG - Intergenic
1049782322 8:144434677-144434699 CACAGCACCCACCAGGCTGGGGG + Intronic
1051598121 9:18845566-18845588 CACAGCTCACACATTGCAGTTGG + Intronic
1053072712 9:35110672-35110694 TACAGCTCCCAACATGCTGAGGG + Exonic
1053215251 9:36265348-36265370 CAGAGCTCCCAACATGGTGGCGG - Intronic
1053424858 9:38004072-38004094 CACAACTCCCAGGTTCCTGGAGG + Intronic
1053430929 9:38041299-38041321 CACAGCCCCCGCCTGACTGGTGG - Intronic
1059493709 9:114691751-114691773 CACAATTCCCACCTTGCTCAGGG + Intergenic
1060009068 9:120027419-120027441 CAGAGCTACCTCCTTGATGGGGG - Intergenic
1060269024 9:122128249-122128271 CTCTGCTCCCCACTTGCTGGGGG - Intergenic
1060730554 9:126034192-126034214 CACAGCTCCCACCTTGCCTTGGG + Intergenic
1061088221 9:128411695-128411717 CTCAGCTCCCCCCATTCTGGGGG - Intergenic
1061136877 9:128739825-128739847 CAGAGCTCCCACCTTCCTTCTGG - Intronic
1061515510 9:131087707-131087729 CCCAGCACCCACCTTTCAGGGGG - Exonic
1061765794 9:132880458-132880480 CACAGCTCCCACCATGATGAGGG + Intronic
1062502729 9:136858266-136858288 CAGGGCTCCCACCTGGCTGAGGG - Exonic
1062568028 9:137171870-137171892 CAGAGCTCCCACCTTGCCTGGGG + Exonic
1186182372 X:6985749-6985771 CTCAGTGCCCACCTTCCTGGAGG + Intergenic
1186396334 X:9212581-9212603 CCCAGCTGACACCTTGCTTGTGG - Intergenic
1189281097 X:39820705-39820727 CACAGGTACCACCTGGGTGGTGG - Intergenic
1189689897 X:43605081-43605103 CACAGCTGACACCTTGATTGAGG + Intergenic
1196310741 X:114162310-114162332 CACAGCAGCCCCATTGCTGGGGG + Intergenic
1196766611 X:119251580-119251602 CACAGGCCCCACCCTGCTGGAGG + Intergenic
1199942209 X:152637869-152637891 CACAGATCCCAGCTCGCTGCTGG - Intergenic
1200233799 X:154458732-154458754 CACACCCCCCACCGTGCTGCTGG - Intronic