ID: 1102200649

View in Genome Browser
Species Human (GRCh38)
Location 12:111055627-111055649
Sequence CTCCCGCCTGGCCCCCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102200640_1102200649 18 Left 1102200640 12:111055586-111055608 CCTGGAGGGGGCGAGGAGAGAAA 0: 1
1: 0
2: 1
3: 30
4: 333
Right 1102200649 12:111055627-111055649 CTCCCGCCTGGCCCCCAAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 243
1102200636_1102200649 29 Left 1102200636 12:111055575-111055597 CCGTCTGCCTCCCTGGAGGGGGC 0: 1
1: 0
2: 6
3: 36
4: 439
Right 1102200649 12:111055627-111055649 CTCCCGCCTGGCCCCCAAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 243
1102200638_1102200649 22 Left 1102200638 12:111055582-111055604 CCTCCCTGGAGGGGGCGAGGAGA 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1102200649 12:111055627-111055649 CTCCCGCCTGGCCCCCAAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 243
1102200639_1102200649 19 Left 1102200639 12:111055585-111055607 CCCTGGAGGGGGCGAGGAGAGAA 0: 1
1: 0
2: 2
3: 31
4: 317
Right 1102200649 12:111055627-111055649 CTCCCGCCTGGCCCCCAAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 243
1102200642_1102200649 -5 Left 1102200642 12:111055609-111055631 CCAAGGCCCAGCTCCTGCCTCCC 0: 1
1: 2
2: 41
3: 205
4: 1312
Right 1102200649 12:111055627-111055649 CTCCCGCCTGGCCCCCAAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102200649 Original CRISPR CTCCCGCCTGGCCCCCAAGG TGG Intronic
900371112 1:2332596-2332618 CGCCCTCCTGGCCCCCAACCTGG - Intronic
900418718 1:2546489-2546511 CCCCTGCCTGGCCCCGCAGGAGG - Intergenic
900538949 1:3193284-3193306 CTCCTGCCCGGCCCCCCAAGGGG + Intronic
902236262 1:15059461-15059483 CTTCCTCCTGGCCTCCGAGGTGG - Intronic
903177662 1:21590383-21590405 CCCCCACCACGCCCCCAAGGAGG + Intergenic
903646434 1:24898885-24898907 CTCCCACCTTGCCAGCAAGGAGG - Intergenic
904090537 1:27941894-27941916 TGCCCACCTGGACCCCAAGGAGG + Intronic
904599470 1:31665662-31665684 CTCCTGCCTGGCTGCCCAGGTGG + Intronic
905387227 1:37613295-37613317 CTCTTGCCTGGCCCCAGAGGTGG - Intronic
905860782 1:41349803-41349825 CTCCCGCATGGCTCCCCAGCAGG - Intergenic
906168641 1:43706318-43706340 CTCCCTCCTGGGGCCCAGGGAGG + Intronic
906960949 1:50419213-50419235 CGGCCGCCAGGCCCCCACGGTGG + Exonic
910364419 1:86448909-86448931 CTCCAGGCTGGCCCACAGGGTGG - Intronic
911247044 1:95529630-95529652 CTCCTCCCTGGCCCCCAAAAAGG + Intergenic
915237720 1:154497710-154497732 CTCCAGCCTGGCCAACAAGAGGG - Intronic
915347687 1:155206281-155206303 CTTCCGCCTGCCCCCCAAGCAGG - Exonic
915624848 1:157108098-157108120 CTCCCACCTCACCCCCAAAGAGG - Intergenic
918834892 1:189449711-189449733 CTCCCGCCTGGCCTCCCAAAAGG + Intergenic
919753221 1:201051178-201051200 CTCCTGCCTGGCCCCTCAGAAGG + Intronic
920409272 1:205746261-205746283 CTCCCGCCTGGGCAACAAGAGGG + Intronic
922819072 1:228471439-228471461 CTCCAGCCTGCGCCCCACGGAGG - Intergenic
1063882001 10:10540992-10541014 CTCCAGCCTGGGCGACAAGGTGG + Intergenic
1064123673 10:12640988-12641010 CTCCAGCCTGGGCAACAAGGTGG - Intronic
1065796464 10:29312713-29312735 CCCCCTCCTGGCTCCCATGGCGG + Intronic
1066080657 10:31928328-31928350 CGCCCGCCCCGCCCCCAGGGAGG - Intronic
1067828340 10:49595580-49595602 CTCCCTCCAGGCACCCCAGGTGG - Intergenic
1069631252 10:69898255-69898277 CTCCCTTCTGTCCCCCAAGCAGG + Intronic
1073269748 10:102252304-102252326 CTCCAGCCTGGGCAACAAGGGGG + Intronic
1075798211 10:125135804-125135826 CTCCTGCCTGGCCCCACAGCAGG + Intronic
1076331700 10:129675153-129675175 CTCCCGCCTGGCCCTCAGCTGGG - Intronic
1077023088 11:428315-428337 CTCCCGCCGGGTCCCCCAAGAGG + Intronic
1077107023 11:846622-846644 CCCCAGCCTGGCACCCATGGTGG + Intronic
1077201275 11:1308947-1308969 CTCCCTGATGGCCCCCCAGGTGG - Intronic
1080505524 11:32909469-32909491 CTCCAGCCTGGGCCACAAGAAGG - Intronic
1080751480 11:35154301-35154323 CTCCTGCCTGACCCCAAAAGAGG - Intronic
1081586652 11:44389607-44389629 CTCCCTGCTGGGCACCAAGGGGG + Intergenic
1081673387 11:44954323-44954345 CTCACACCTGGCCACCAAGGAGG - Intergenic
1081856132 11:46305017-46305039 GTGCGGCCTGGCCTCCAAGGTGG + Intronic
1083246109 11:61429628-61429650 CACCTGCCTAGCCCCCAAGGCGG + Intronic
1083572500 11:63768211-63768233 CTCGGGCCTGGCCCCCAAGGCGG + Intronic
1085384697 11:76150333-76150355 TTCCCGCCTGGCCCCTGAAGAGG + Intergenic
1089460541 11:118650564-118650586 ATCCTGGCTGGCCCCCAGGGTGG - Intronic
1092409390 12:8242607-8242629 CGCGCGTCTGCCCCCCAAGGCGG + Intergenic
1093872698 12:24311120-24311142 CTACCTCCTGGCCCCCCATGGGG - Intergenic
1095947724 12:47763366-47763388 CTCCCAGCTGGCCTCCAAGCTGG - Intronic
1096711235 12:53457958-53457980 CTCCAGCCTGGGCGACAAGGAGG - Intronic
1097711578 12:62923429-62923451 CTCCCTCTTGGCCCCCAGGCTGG + Intronic
1100585692 12:95977396-95977418 CTCCCACCTCACCCCCAAAGTGG - Intronic
1102200649 12:111055627-111055649 CTCCCGCCTGGCCCCCAAGGTGG + Intronic
1103224975 12:119279089-119279111 CTCCAGCCTGGGCCACAAGAGGG + Intergenic
1105302950 13:19151829-19151851 CTGCAGCCTGGGCCCCAGGGAGG - Intergenic
1106124230 13:26886966-26886988 CTCCTGCCTGGCACCCTTGGTGG - Intergenic
1108767565 13:53651176-53651198 CTCCCACCAGGCTCCAAAGGAGG - Intergenic
1110383726 13:74883693-74883715 CTCCAGCCTGGGCACCAAGAGGG + Intergenic
1112210336 13:97370635-97370657 CTCCAGCCTGGCCAACAAGAGGG + Intronic
1113145177 13:107200204-107200226 GTCCTCCCTGACCCCCAAGGGGG - Intronic
1113811327 13:113144253-113144275 CTCCCTCCGGGCAGCCAAGGAGG + Intronic
1113868866 13:113546074-113546096 CTCCCACCTCTCCCCAAAGGGGG - Intronic
1114618523 14:24081355-24081377 CGCCCGCCTGGCCGCCCAGCTGG - Exonic
1117865614 14:60145640-60145662 CTCCAGCCTGGCCAACAAGAGGG + Exonic
1119643237 14:76330085-76330107 CTCCCTGCTGGCCGGCAAGGAGG - Intronic
1119667897 14:76498131-76498153 CTGCCTCCTGGACCCCAAGATGG + Intronic
1121199573 14:92106306-92106328 CTCCCTCCCGGCTCCCAGGGCGG + Intronic
1122610006 14:102975848-102975870 CCCCCGCCTGGCCCCGGAGCCGG + Intronic
1122725089 14:103745269-103745291 CTCTTGCCTGGCCCCCAGGAGGG - Intronic
1123688597 15:22818402-22818424 CTCCAGCCTGGGCACCAAGAGGG + Intronic
1123911590 15:24973427-24973449 CTCCAGCCTGGGCAACAAGGAGG - Intronic
1124934012 15:34152447-34152469 CTCACGCCTGGAGCCCGAGGTGG - Intronic
1125726737 15:41871959-41871981 GGCCCGACTGGCCCCCAGGGGGG - Intronic
1127915843 15:63454214-63454236 CTCCAGCCTGGGCAACAAGGGGG - Intergenic
1128386573 15:67153478-67153500 CCCCCGCCCGCCCCCCAAGACGG - Intronic
1128750003 15:70141989-70142011 CTCCCGCGTGGCGCTGAAGGTGG + Intergenic
1130301147 15:82680521-82680543 CTTCCACCTGGCGCCCAAGGCGG - Exonic
1130531061 15:84748365-84748387 CTCCCGCCTCCCGCCCGAGGCGG - Intergenic
1131082404 15:89547591-89547613 CTCCAGCCTGGGCAACAAGGGGG + Intergenic
1132578254 16:673790-673812 CTCCTGCCGGACCCCCAGGGTGG + Exonic
1132800593 16:1750674-1750696 CTCCAGCCTGGCCCACAAAGTGG - Intronic
1132886986 16:2186672-2186694 CTCCTGCCTGCCCCCCAGGGTGG + Intronic
1136088770 16:27903639-27903661 CTCCCTCCAGGGCCCCAAGGGGG - Intronic
1136690655 16:32025839-32025861 CTCACTCCTGGCCCCCCAGAGGG - Intergenic
1136791240 16:32969400-32969422 CTCACTCCTGGCCCCCCAGAGGG - Intergenic
1136878574 16:33884532-33884554 CTCACTCCTGGCCCCCCAGAGGG + Intergenic
1137716253 16:50600077-50600099 CTACCCCCTGGCCCCCACAGTGG - Intronic
1139326934 16:66160014-66160036 TTCCTGCCTAGTCCCCAAGGGGG - Intergenic
1139851404 16:69953026-69953048 CTCCTGCCTGGGACCCCAGGAGG + Intronic
1139880382 16:70175938-70175960 CTCCTGCCTGGGACCCCAGGAGG + Intronic
1140310881 16:73847267-73847289 CTCCAGCCTGGGCCACAAGAGGG + Intergenic
1140372128 16:74419579-74419601 CTCCTGCCTGGGACCCCAGGAGG - Intronic
1140455130 16:75100507-75100529 CTCCCTCATCGCCCCCCAGGAGG - Intronic
1140507418 16:75482504-75482526 CTCCAGCCTGGGCAACAAGGGGG + Intronic
1142146693 16:88495771-88495793 CACCACCCTGGCCCCCAAGTGGG - Intronic
1203093449 16_KI270728v1_random:1230862-1230884 CTCACTCCTGGCCCCCCAGAGGG - Intergenic
1143166402 17:4899304-4899326 GGGCCGCCTCGCCCCCAAGGCGG - Exonic
1143324145 17:6087552-6087574 CTTCTCTCTGGCCCCCAAGGAGG + Intronic
1143683352 17:8494113-8494135 CTCCAGCCTGGGCCCCTGGGTGG - Intronic
1143757872 17:9079838-9079860 CTGTTTCCTGGCCCCCAAGGAGG + Intronic
1144622277 17:16825078-16825100 CTCCAGCCTGCCCCAAAAGGAGG + Intergenic
1144881230 17:18431859-18431881 TTCCCGGCCGGCCCCCCAGGAGG + Intergenic
1145148082 17:20496742-20496764 CTCCAGCCTGCCCCAAAAGGAGG + Intergenic
1145151002 17:20512527-20512549 TTCCCGGCCGGCCCCCCAGGAGG - Intergenic
1147153519 17:38531982-38532004 CTCACTCCTGGCCCCCCAGAGGG - Exonic
1147574248 17:41589409-41589431 CTCCAGCCTGCCCCAAAAGGAGG + Intergenic
1148050024 17:44765301-44765323 CAGCCACCTGGCCCACAAGGTGG + Intronic
1148332009 17:46818853-46818875 CTCCCGCCCGGCCCACAACTCGG + Intronic
1148391400 17:47275648-47275670 CTCCCGCCCCTCCCCCCAGGCGG - Intronic
1150191557 17:63245809-63245831 CTCCAGCCTGGGCAACAAGGCGG + Intronic
1150656549 17:67043534-67043556 CACCCGCCTGGCCCCCAGGCTGG - Intergenic
1151550807 17:74821524-74821546 ATCCCTCCTGGCACCCAGGGAGG - Intronic
1151824142 17:76514202-76514224 CCCCAGCCTGGCCCCCAGGTAGG + Intergenic
1152625987 17:81388185-81388207 CTCCCGCCTGGCGCCAAACACGG - Intergenic
1153640390 18:7151758-7151780 CTCCAGCCTGGCCAACAAGAGGG + Intergenic
1155654500 18:28177718-28177740 CTCCGGCCTCGGCCGCAAGGGGG + Intergenic
1157963142 18:52179242-52179264 CTGCACCCTTGCCCCCAAGGTGG - Intergenic
1158590428 18:58774427-58774449 TGCCCTCCTCGCCCCCAAGGTGG + Intergenic
1160185705 18:76674776-76674798 CTCCTGCCTGGAGCCCCAGGAGG - Intergenic
1160793887 19:935039-935061 CTCCCGCCCGGCCCCTACTGGGG + Intronic
1161363164 19:3863014-3863036 ATGCGCCCTGGCCCCCAAGGTGG + Intronic
1161612539 19:5251176-5251198 CTCCAGCCTGTAGCCCAAGGAGG + Intronic
1161709971 19:5842145-5842167 CTCCCACCTGGGCCTCAGGGAGG + Intergenic
1161975919 19:7607736-7607758 CTACCCCCTCCCCCCCAAGGTGG + Intronic
1162028700 19:7908314-7908336 CTCCTGCCTGGTCCTCCAGGAGG + Intronic
1162959709 19:14118381-14118403 CCGCGGCCTGGCCCCCAAGCAGG - Intergenic
1163089361 19:15008311-15008333 CTCCAGCCTGGGCCACAAAGTGG + Intronic
1163262874 19:16201805-16201827 CTCCAGCCTGGCCCCTTAGCTGG - Intronic
1163427010 19:17245510-17245532 CCCCCGCCGGGGCCCCAGGGCGG - Exonic
1164101881 19:22062512-22062534 CTCCAGCCTGGGCAACAAGGAGG - Intronic
1166704906 19:44903268-44903290 GTCCCCCCCGACCCCCAAGGGGG - Exonic
924962201 2:45701-45723 CTGCGGCCTGGACCCCGAGGTGG - Exonic
925046048 2:773794-773816 CCCCAGCCTGCCCCCCAAGCAGG + Intergenic
925390919 2:3493326-3493348 TCCCTGCCTGTCCCCCAAGGAGG - Intergenic
928164114 2:28957070-28957092 CTCCAGCCTGGGCCACAAGAGGG + Intronic
929370886 2:41222813-41222835 CTCCTGCAGGTCCCCCAAGGAGG - Intergenic
929468714 2:42169716-42169738 CTCCCGCCTGCCCCTCGGGGTGG + Intronic
929596433 2:43179133-43179155 CTCAAGCCTGGCCCCCAGGCTGG + Intergenic
929761066 2:44806548-44806570 CTCCCTCCAGTCCCCCAGGGAGG + Intergenic
930926472 2:56824004-56824026 CTCCAGAGTGGCCCCCAAAGTGG - Intergenic
933745041 2:85564488-85564510 CTCCAGCCTGGGCAACAAGGGGG - Intronic
934857719 2:97739429-97739451 CTACAGCCTGGCCAGCAAGGTGG + Exonic
936522125 2:113218002-113218024 CTCCCGCCTGCCCCACACGGAGG - Exonic
938289013 2:130139833-130139855 CTGCAGCCTGGGCCCCAGGGAGG - Intronic
938467516 2:131533105-131533127 CTGCAGCCTGGGCCCCAGGGAGG + Intronic
938607905 2:132915409-132915431 TTCCCTCCTGGGCCCCAAAGTGG - Intronic
941306224 2:163871364-163871386 CTCCAGCCTGGGCCCCAAGAAGG - Intergenic
942046393 2:172101703-172101725 CCCCCGCCGGGCCCTCTAGGAGG - Intronic
943521069 2:188949705-188949727 TTCCCTCCTGCCCGCCAAGGGGG + Intergenic
947549865 2:231038135-231038157 CTCCTGCCTGGCCGTCCAGGCGG + Exonic
947840941 2:233207633-233207655 CTCCAGCCTGGCTGCCAGGGAGG + Exonic
948225777 2:236308322-236308344 CTCCTGCCAGCCCTCCAAGGGGG - Intergenic
948850120 2:240701700-240701722 CCGCCGCCTGGCCCCGAGGGTGG - Intergenic
949017667 2:241722462-241722484 CCCCTGCCTGGGCCCGAAGGTGG + Intronic
1172148558 20:32774748-32774770 CTCCAGCCTGGGCGACAAGGGGG - Intronic
1172687255 20:36765521-36765543 CTCCAGCCTGGGCAACAAGGTGG + Intronic
1173539580 20:43841332-43841354 CTCCAGCCTGGGCCACAGGGTGG - Intergenic
1174062112 20:47840095-47840117 CTACCCACTGGCCCCCAACGCGG + Intergenic
1175340922 20:58228548-58228570 CTCTCGCCTGCACCCCAATGCGG - Exonic
1175421220 20:58835078-58835100 CTCCCGCCTGTTCCCCAGAGAGG - Intergenic
1175824120 20:61927447-61927469 CTCCCTCCTGGCCCGGCAGGAGG - Intronic
1176240604 20:64074143-64074165 ATCCATCCTGTCCCCCAAGGAGG - Exonic
1177118645 21:17114976-17114998 CTCCAGCCTGGGCAACAAGGGGG + Intergenic
1179895286 21:44358381-44358403 CTCCTTCCTGCCACCCAAGGGGG - Intronic
1181052693 22:20245330-20245352 CTCCAGCCTGGCCCCCCTTGGGG + Intronic
1181166068 22:20983716-20983738 CTCAAGCCCGCCCCCCAAGGAGG - Intronic
1182129949 22:27843628-27843650 CTCCCTCCTGGGCACCAAGCTGG - Intergenic
1182292568 22:29292794-29292816 CTCCAGCCTGGGCACCAAGAAGG - Intronic
1182519950 22:30879558-30879580 CACCTGCCTGACCCCCGAGGCGG - Intronic
1184257214 22:43294195-43294217 CTCACCCCCGGCCCCCGAGGAGG + Intronic
1184776822 22:46627492-46627514 CTCCCGCCTGGCTCCCCACCTGG - Intronic
1185001626 22:48249987-48250009 CCACAGCCTGGCTCCCAAGGCGG + Intergenic
1185224321 22:49644226-49644248 GGCCCGCCTGGCCCCCATGGTGG - Intronic
1185294425 22:50046279-50046301 CTCCCTCCAGGCCCCCAAACGGG + Intronic
950170848 3:10838168-10838190 CTCCAGCCTGGCACCCAGGAGGG - Intronic
950863934 3:16174235-16174257 CTCTGCCCTGGCCACCAAGGGGG - Intergenic
951139875 3:19147507-19147529 CTCCCCCCTGGCCCCCCCCGCGG - Intergenic
952860268 3:37807050-37807072 CCCCTCCCTTGCCCCCAAGGAGG + Intronic
954240579 3:49290380-49290402 CTCCAGCCTGGCCAACAAAGTGG + Intronic
954442164 3:50527819-50527841 CTGCAACTTGGCCCCCAAGGTGG + Intergenic
959047462 3:101490151-101490173 CTCCAGCCTGGGCAACAAGGGGG + Intronic
961017653 3:123480072-123480094 GCCCAGCCTGGCCCCCAAGCTGG - Intergenic
961481559 3:127183979-127184001 CACCTGCCTGGCCCCCATGGTGG + Intergenic
962486269 3:135845600-135845622 CTCCCTCTGTGCCCCCAAGGAGG + Intergenic
964499722 3:157335363-157335385 CTCCAGCCTGGGCAACAAGGAGG + Intronic
965211194 3:165791288-165791310 TTCCCGCCCGCCCCCCAAGATGG - Intronic
966189138 3:177255955-177255977 CTCCAGCCTGGGCACCAAGAGGG - Intergenic
967984824 3:195086959-195086981 CTCCCACCTGTACCACAAGGAGG + Intronic
968433682 4:574731-574753 CTCCGGCCTGGCCCCCTCTGCGG - Intergenic
968659319 4:1792685-1792707 CTACCCCCCGCCCCCCAAGGAGG - Intergenic
969478586 4:7434941-7434963 CTCCTGCCTGGCCCCAGAGGAGG + Exonic
971732408 4:30402217-30402239 CTCCTGCCTGAGGCCCAAGGTGG + Intergenic
972623894 4:40777362-40777384 CTCCCGCCTGGGCAACAAGAGGG - Intronic
975415190 4:74097880-74097902 CCCCAGCCTGGCACCCAAGTGGG + Intronic
977887809 4:102272851-102272873 CTCCCTCCTGGAGCCAAAGGAGG + Intronic
983934871 4:173494633-173494655 CGCCCTCCTGGTGCCCAAGGAGG - Intergenic
985727025 5:1522036-1522058 CTCCCTCCTGGCTCCCTGGGGGG - Intronic
986236102 5:5912237-5912259 TACCTGCCTGGCCCCCAGGGAGG + Intergenic
992104093 5:73436364-73436386 CCCCCGCCCGGCCCCCAGCGAGG + Intergenic
995757356 5:115522117-115522139 CTCCCACCCAGCCCCCAAAGAGG + Exonic
996619504 5:125482905-125482927 CTCCCGCCTGTCACCCAGGCTGG - Intergenic
999462948 5:151772310-151772332 CCGCCGCCTGGGCCCCAGGGCGG + Intronic
1000110997 5:158107989-158108011 CCCCTTCCTGGCCCCCAGGGTGG + Intergenic
1001278750 5:170370678-170370700 CTCCCATCTGTCCCTCAAGGAGG + Intronic
1002519363 5:179782759-179782781 CTCTTGCCTGGCTGCCAAGGAGG - Intronic
1002581091 5:180209622-180209644 CTCTCCCGTGGCCCCCAGGGAGG + Intergenic
1006075528 6:31529824-31529846 CTCCCTCCTGCCCTTCAAGGAGG - Exonic
1006594335 6:35182067-35182089 CTCCTTGCTGGGCCCCAAGGAGG + Intergenic
1007784837 6:44273581-44273603 CTCCCACCTTCCCCCCAGGGAGG - Intronic
1011258649 6:85449968-85449990 CTTGCGCCTGGCCGCCAAGCCGG + Intronic
1017503860 6:155049314-155049336 CTCCCTCCTGACCACCACGGAGG - Intronic
1017807051 6:157955013-157955035 CTCCCACGTGTCCCCCTAGGTGG - Intergenic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1019601454 7:1885810-1885832 CTCCAGCCTGGCCCCTAGGCCGG + Intronic
1019692195 7:2422274-2422296 CTCCAGCCTGGGCCACAAGAGGG - Intronic
1019771627 7:2886912-2886934 CTCCACCCTGGCCCCCCTGGTGG - Intergenic
1019776179 7:2913246-2913268 CTCCCGCGGGGCTCCCCAGGTGG + Intronic
1019894472 7:3972917-3972939 CTCCAGGGTGGCCCCCAGGGGGG - Intronic
1020011780 7:4809237-4809259 CTCGGGCCTGGCCGCCAAGCTGG + Intronic
1020084945 7:5305215-5305237 CGCCCACCTGGGCCCCAGGGAGG - Exonic
1024199394 7:47090617-47090639 GTCATGCCTGGCCACCAAGGAGG - Intergenic
1026049284 7:66931501-66931523 CTCCAGCCTGGCCAACATGGTGG - Intronic
1026091576 7:67304746-67304768 ACCGCGCCTGGCCCCAAAGGTGG + Intergenic
1029122048 7:98274939-98274961 CTTGCGCCTGTCCCCCAGGGAGG + Intronic
1032401792 7:131629208-131629230 CTCCCGCCTGGCCCTCGGGTGGG - Intergenic
1032525906 7:132577868-132577890 CCCCCACATGGCACCCAAGGAGG + Intronic
1035203218 7:157279611-157279633 CGGCCGCCAGGCCCCCAGGGTGG - Intergenic
1035727573 8:1834207-1834229 AACCCGCCTGGGCCCCAAGCAGG - Intronic
1037841797 8:22250235-22250257 GTCCCTCCTTGCCCCTAAGGAGG - Intronic
1037977982 8:23226457-23226479 CTCCAGCCTGGGCCACAAGAGGG + Intergenic
1038457448 8:27686570-27686592 CAGCAGCCTGGCCCCCCAGGAGG - Intergenic
1049128730 8:140817059-140817081 ATCCCATCTGGCCCCCAGGGAGG + Intronic
1049332895 8:142064653-142064675 CTGCTGCCTGGCCCCAAAGAGGG - Intergenic
1049407911 8:142459954-142459976 ATCCCTCCTGGCACCCAGGGTGG - Intronic
1049453496 8:142675315-142675337 CTCCTGCCTGGGCACTAAGGTGG - Intronic
1049569746 8:143363749-143363771 CTCCAGCCTGGCCCCTGAGCTGG + Intergenic
1050731260 9:8712748-8712770 CTCCAGCCTGGGCAACAAGGAGG - Intronic
1051499256 9:17759133-17759155 ATCCCACCTGGCCCACAGGGAGG - Intronic
1053288439 9:36864675-36864697 CTCCGGCCTGGCCAGCATGGTGG + Intronic
1053510396 9:38682985-38683007 AGCCAGCCTGGCCCCCAAGGAGG + Intergenic
1054880158 9:70136117-70136139 CTCCAGCCTGGACCACAAAGTGG + Intronic
1055045318 9:71918149-71918171 CTCCAGCCTGGGCCACAGGGAGG + Intronic
1055348200 9:75358541-75358563 CTCTCCCCTGCCCCCAAAGGAGG - Intergenic
1056346958 9:85706476-85706498 CTCCAGCCTGGGCCACATGGTGG + Intronic
1056703537 9:88932046-88932068 CTCCTGCCTGGCACCCAGGAGGG + Intergenic
1057297765 9:93859494-93859516 CTCCAGCCTGGCCCCTAACAGGG + Intergenic
1060005412 9:119995079-119995101 CTCCAGCCTGGGCAACAAGGTGG + Intergenic
1060802836 9:126555558-126555580 CTCCAGCCTGGGCCACAAGAGGG + Intergenic
1060855492 9:126911913-126911935 CTCACGCCTGTCTCCCAAGGTGG - Intergenic
1061183106 9:129036693-129036715 CCCCGGCCGAGCCCCCAAGGCGG + Intronic
1061887271 9:133598137-133598159 CCGCCGCCTGGCTCCCAGGGAGG - Intergenic
1061909008 9:133713000-133713022 AGCCCTCCTGGCCCCCAAGAGGG - Intronic
1062524027 9:136971024-136971046 CACCCTCCCGGCCTCCAAGGGGG - Exonic
1203794666 EBV:169984-170006 CGCCAGCCAAGCCCCCAAGGGGG + Intergenic
1203794867 EBV:170522-170544 CGCCAGCCAAGCCCCCAAGGGGG + Intergenic
1203795058 EBV:171045-171067 CGCCAGCCAAGCCCCCAAGGGGG + Intergenic
1203795259 EBV:171583-171605 CGCCAGCCAAGCCCCCAAGGGGG + Intergenic
1186193529 X:7089162-7089184 CTCCCACCTGTGCCCCCAGGTGG - Intronic
1186200051 X:7147891-7147913 CCCCCGGCTGGCCCCGAAGTCGG - Intronic
1186403997 X:9285678-9285700 CTCTAGCCTGGCACCCCAGGGGG - Intergenic
1188064853 X:25646321-25646343 CCCCCGCCGCGCCCCCATGGCGG - Intergenic
1189443503 X:41058595-41058617 CTCCAGCCTGGGCTTCAAGGTGG + Intergenic
1192260940 X:69505521-69505543 CTCCCGGCCGGCCCCCCATGGGG - Exonic
1200144120 X:153917376-153917398 CTCCAGCCTGGGCGACAAGGGGG + Intronic