ID: 1102201125

View in Genome Browser
Species Human (GRCh38)
Location 12:111058677-111058699
Sequence CTGTAACACCACTATCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102201125_1102201136 28 Left 1102201125 12:111058677-111058699 CCTTGCAGATAGTGGTGTTACAG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1102201136 12:111058728-111058750 TCTCACGCAAGAAAGAATTCAGG 0: 64
1: 351
2: 536
3: 615
4: 585
1102201125_1102201137 29 Left 1102201125 12:111058677-111058699 CCTTGCAGATAGTGGTGTTACAG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1102201137 12:111058729-111058751 CTCACGCAAGAAAGAATTCAGGG 0: 62
1: 362
2: 564
3: 763
4: 898

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102201125 Original CRISPR CTGTAACACCACTATCTGCA AGG (reversed) Intronic
903266048 1:22158733-22158755 CTGTAAAACTACTGTCTGCCAGG + Intergenic
904550750 1:31315303-31315325 CTGAAACACCACCTTCTTCAAGG - Intronic
905142102 1:35855557-35855579 CTTTCATCCCACTATCTGCAGGG - Exonic
906565998 1:46801503-46801525 CTCTAACACAACTGTCTGAAGGG + Intronic
908870036 1:68599888-68599910 CTGTAAGACCACAAGCTGTAAGG + Intergenic
911998442 1:104798153-104798175 CTGTCACACCACAATTTTCATGG + Intergenic
922688912 1:227671420-227671442 CCGTCACACCAATATGTGCATGG - Intronic
923894192 1:238250882-238250904 CTTTAACCCTACTTTCTGCAAGG - Intergenic
924165235 1:241274460-241274482 CTCTAACACAACTATGTACATGG + Intronic
1069628870 10:69885472-69885494 CTGGGACACCACTTTCTGGAGGG - Intronic
1069658485 10:70107720-70107742 TTGAAACCCCACTCTCTGCAGGG + Intronic
1070396386 10:76014528-76014550 ATGAACCAGCACTATCTGCAGGG - Intronic
1071538722 10:86459119-86459141 ATGTAACACCACATTCTGCCTGG + Intronic
1072228599 10:93393451-93393473 CTGTAACCCCATGGTCTGCAGGG + Intronic
1077429072 11:2506762-2506784 CTGTCACACCACTTTTTGCCAGG + Intronic
1078604336 11:12761872-12761894 CTTGAACACCACTAACAGCAGGG - Intronic
1078800757 11:14642916-14642938 CTGTAACAGCACTTTCTAGATGG - Intronic
1079806797 11:24941551-24941573 ATATAACAACACTTTCTGCAGGG + Intronic
1080671410 11:34382690-34382712 CTGTGCCACCCCTAGCTGCAAGG - Intergenic
1083511225 11:63210958-63210980 CTTTAGCACCTCTATCTCCAGGG - Intronic
1083878104 11:65535331-65535353 CTGCAACACCACAGTCTGCCTGG + Exonic
1092116244 12:6010324-6010346 CTGTAACAACACACTCAGCAAGG + Intronic
1093451603 12:19322585-19322607 TTGTAACACCACTGTCTGAATGG - Exonic
1094143772 12:27207646-27207668 TTTGACCACCACTATCTGCAAGG - Intergenic
1095234386 12:39778954-39778976 CTGAAAAACCACTAATTGCAGGG + Intronic
1102201125 12:111058677-111058699 CTGTAACACCACTATCTGCAAGG - Intronic
1103105185 12:118218162-118218184 CTGTAATACCAGTATCTGTTTGG - Intronic
1106933676 13:34694977-34694999 TTGGAACATCACTACCTGCAAGG - Intergenic
1109183667 13:59244945-59244967 TTGCAACATCTCTATCTGCACGG + Intergenic
1120529467 14:85614657-85614679 CTATGAAACCACAATCTGCAGGG + Intronic
1124963984 15:34419619-34419641 CTGTAGCTCCACCCTCTGCAAGG - Intronic
1124980598 15:34565850-34565872 CTGTAGCTCCACCCTCTGCAAGG - Intronic
1125993982 15:44138474-44138496 TTATAACTCCACTATCTTCAAGG - Intronic
1126858392 15:52860907-52860929 CTCTACCACCAAAATCTGCATGG + Intergenic
1127861145 15:62995119-62995141 CTGTAATACCACAATCTCAATGG - Intergenic
1128236737 15:66072855-66072877 CTGTTGCCCCACTGTCTGCAAGG + Intronic
1129524185 15:76203733-76203755 CTGGGACACCGCTGTCTGCAAGG - Exonic
1133034155 16:3025700-3025722 CTGGAACACCTCTGTCTGCAGGG - Exonic
1135015160 16:18919002-18919024 TTGTAAAACCACTGTCTTCAAGG - Intronic
1136332259 16:29587956-29587978 TTGTAAAACCACTGTCTTCAAGG - Intergenic
1136446954 16:30328025-30328047 TTGTAAAACCACTGTCTTCAAGG - Intergenic
1139198845 16:64951553-64951575 CTGTCACACCATTTTCTGCTGGG + Intronic
1143163133 17:4884440-4884462 CTGTATCGCCTATATCTGCAGGG + Exonic
1156380537 18:36556177-36556199 CTGTAATTCCATTATCTTCATGG + Intronic
1157068977 18:44383867-44383889 CTGATTCACCAGTATCTGCAAGG + Intergenic
1159221201 18:65465220-65465242 CTCTGGCACCCCTATCTGCAAGG - Intergenic
1159605290 18:70468587-70468609 ATGAAACACCCCTATATGCAGGG + Intergenic
1160838713 19:1136854-1136876 CGGTAACAACACTCTCTGCCTGG - Intronic
926666882 2:15534939-15534961 TTGTAACAGCATTATTTGCAGGG + Intronic
927011214 2:18906517-18906539 CTGAAGCAGCACTATCAGCAAGG + Intergenic
929253298 2:39781992-39782014 CTGTAACTGCCCTATCAGCAGGG + Intergenic
930378145 2:50593596-50593618 CTGTAAGAACACTAACTGCAGGG - Intronic
930629113 2:53733130-53733152 CTGTATTCCCACTATCTCCATGG - Intronic
935601196 2:104923369-104923391 TTGTAACACCAATACCTGAAAGG + Intergenic
941111069 2:161418884-161418906 CTGTAAAACCACCATCTGTCCGG - Exonic
943730651 2:191300006-191300028 CTGTCTCACCACTTTCTGCATGG + Intronic
945022544 2:205588630-205588652 CTGTACCACCACTAGCATCAAGG - Intronic
946674521 2:222144595-222144617 ATGTATCACCACTATCTAGATGG - Intergenic
948901595 2:240959205-240959227 CTGCAACACCTCTCTCTCCAGGG + Intronic
1170873028 20:20225482-20225504 CTGTAACACCAACAGCTGCCGGG - Intronic
1170901300 20:20465927-20465949 TTGAAACTCCAGTATCTGCAAGG + Intronic
1173758961 20:45543058-45543080 CTGCAACAACCCTATCTCCAGGG - Intronic
1175576248 20:60062908-60062930 CTGCAACGCCACTGTCTGCCAGG + Intronic
1179029394 21:37707240-37707262 CTATCACAGCACTAACTGCAAGG + Intronic
1179276528 21:39896960-39896982 CTGTGATGCCACTATCTGAATGG - Intronic
1179317039 21:40253193-40253215 CTGTAGCACAAGTCTCTGCAAGG + Intronic
1180172185 21:46065309-46065331 CTGAAACACCACCAGCCGCAGGG - Intergenic
1185053852 22:48567784-48567806 GTGTGACACCGCTGTCTGCAGGG + Intronic
950141998 3:10621948-10621970 CTGGAGCAGCACTAGCTGCACGG + Intronic
952193481 3:31047742-31047764 CTGCAACAACACTATCAGCTAGG + Intergenic
953769616 3:45770037-45770059 CTTTAACACCACTCTCTTGAGGG - Intronic
957520481 3:81312456-81312478 CTTTACCATCACTCTCTGCATGG - Intergenic
961865662 3:129951856-129951878 CTGTGACACCACTGTAAGCATGG - Intergenic
963249746 3:143092206-143092228 ATGTAACCCCACTGTATGCAGGG + Intergenic
964022681 3:152033045-152033067 CTGTTGAACCTCTATCTGCAAGG + Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
967527955 3:190515407-190515429 CTGAAAACCCACTGTCTGCAAGG - Intronic
967789407 3:193531143-193531165 CTTTTACACCAGTATATGCAAGG - Intronic
968938424 4:3625443-3625465 CTGTAACCCAAATATCTCCAGGG - Intergenic
974226502 4:59052149-59052171 CTGTAACAACACTATGTTCTTGG - Intergenic
974260074 4:59516366-59516388 ATATAACACAACTATCTACAAGG - Intergenic
974855716 4:67458221-67458243 CTGGAACACCACCATCTCCTAGG + Intergenic
981298550 4:143160767-143160789 TTGTAACACGACTTACTGCATGG + Intergenic
984245665 4:177272568-177272590 CTGTAACAGGACTAGCTGCTGGG + Intergenic
987309756 5:16670890-16670912 CTGCGACTCCAGTATCTGCAGGG - Exonic
989582070 5:43042491-43042513 CTGTCACAGCACTTGCTGCACGG - Intronic
991245791 5:64506981-64507003 CTGTCACACTTCTTTCTGCAGGG - Intronic
993303200 5:86240106-86240128 CTGTAACACCACTACCGCCACGG - Intergenic
995156754 5:108923916-108923938 TTGTAGCACAGCTATCTGCAAGG + Intronic
997091844 5:130867338-130867360 CTGTATCCCCACTATTTGAAGGG + Intergenic
997340220 5:133138901-133138923 CTGTTACACCACAATCTGACAGG - Intergenic
998449505 5:142223258-142223280 CTTGAAGACCACTTTCTGCAGGG - Intergenic
1003901149 6:10656910-10656932 TTGTAACACCAGACTCTGCAAGG + Intergenic
1008034655 6:46733646-46733668 CTGTCTCACCACTTTCTGCAGGG + Intronic
1010070869 6:71743794-71743816 CTGTAACATAACCCTCTGCATGG + Intergenic
1014492958 6:122084774-122084796 CTGTAACATCAATAACTGGAAGG + Intergenic
1018613921 6:165667785-165667807 TTTTAACACCAGTATCTTCATGG - Intronic
1018963340 6:168464398-168464420 CTGTGCCATCACTATCTGCCAGG + Intronic
1020763795 7:12296650-12296672 CTGTAACACTAATGTCAGCAAGG + Intergenic
1022109436 7:27219533-27219555 CTTTAGCACCACCAGCTGCAGGG + Intergenic
1024462992 7:49679230-49679252 ATGTAGCACCACTGTCTGCAGGG + Intergenic
1029031726 7:97475268-97475290 CTGGATTATCACTATCTGCATGG + Intergenic
1029879695 7:103794783-103794805 CTGTAGCACCACTAGATGCTAGG + Intronic
1033474459 7:141677622-141677644 CTGTGACACCACCTTCTGAAGGG + Intronic
1033888108 7:145972866-145972888 CTTTAACACCACTTTCAGCATGG + Intergenic
1037586201 8:20277987-20278009 CTGTAACACAACTATGTGCCAGG - Intronic
1041136742 8:54767105-54767127 CTGTAACACAACTGTGTACAAGG + Intergenic
1045950584 8:107847705-107847727 CAGGAACACCCCTATCTCCAGGG - Intergenic
1048495597 8:134933265-134933287 CTGAAACACCTCTATCTGTCAGG - Intergenic
1050028587 9:1361648-1361670 TTGTAATACTACTTTCTGCAGGG + Intergenic
1050347584 9:4707572-4707594 CTGTAACATCACAATCTTCCTGG + Exonic
1050463385 9:5895883-5895905 CTGTTACAGCACTTTATGCATGG - Intronic
1053318271 9:37071501-37071523 CTTCAACAACTCTATCTGCATGG - Intergenic
1054452792 9:65412365-65412387 CTGTAACCCAAATATCTTCAGGG + Intergenic
1054859936 9:69940366-69940388 CTGTAATCCCACTATTTGCGAGG + Intergenic
1185618173 X:1435915-1435937 TTGTACCACCACTACCTGCCTGG + Intronic
1190093221 X:47457954-47457976 ATATAACACCACTGTCTGCATGG - Intronic
1198594234 X:138218765-138218787 CAGTAAAACTACTACCTGCAAGG + Intergenic