ID: 1102202047

View in Genome Browser
Species Human (GRCh38)
Location 12:111063945-111063967
Sequence GTCTGGACATGCACCCGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102202044_1102202047 -6 Left 1102202044 12:111063928-111063950 CCAAGTAGGTAGCTGGTGTCTGG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1102202047 12:111063945-111063967 GTCTGGACATGCACCCGGCAAGG 0: 1
1: 0
2: 0
3: 9
4: 79
1102202043_1102202047 -2 Left 1102202043 12:111063924-111063946 CCAGCCAAGTAGGTAGCTGGTGT 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1102202047 12:111063945-111063967 GTCTGGACATGCACCCGGCAAGG 0: 1
1: 0
2: 0
3: 9
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102202047 Original CRISPR GTCTGGACATGCACCCGGCA AGG Intronic
903187037 1:21634611-21634633 GTCTCGGCATGCAGCCAGCATGG - Intronic
907885534 1:58589252-58589274 GTCTGGATCTGCCCCAGGCAGGG - Intergenic
909791439 1:79683212-79683234 TTGTGGACATGCACAGGGCAGGG + Intergenic
920191412 1:204196434-204196456 CTCTGGACATTCACCCAGCCAGG - Exonic
922760370 1:228125861-228125883 GTCTGGACATGGAGCTGGCTGGG - Intergenic
922913755 1:229239152-229239174 GTCTGGCCATGGGCCCTGCATGG - Intergenic
1067520054 10:46993210-46993232 GCCTGGAAATGGACCTGGCAGGG - Intronic
1073642173 10:105263861-105263883 CTATGGACATGCACAAGGCAGGG - Exonic
1074149467 10:110745301-110745323 GCCTGGAAATGCAGCCTGCAGGG - Intronic
1075000625 10:118794524-118794546 GCCTGGACAAGCACCAGGGAAGG + Intergenic
1076707452 10:132309353-132309375 GCCTGGACATGCACCCGCCTAGG + Intronic
1079324934 11:19483796-19483818 GTCTAGAAATGCATCCCGCAAGG + Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1083763876 11:64833016-64833038 CTCTGGACATGCCCCCGTCCTGG - Intronic
1087861381 11:103161917-103161939 GTATGGACATGCACATGGTAAGG - Intronic
1089623745 11:119738127-119738149 ATCTGGACATTCCCCTGGCAGGG + Intergenic
1089655056 11:119941185-119941207 TCCTGGACCTGCAGCCGGCAGGG + Intergenic
1091535399 12:1403277-1403299 CCCTGCACATGCACCTGGCACGG + Intronic
1102202047 12:111063945-111063967 GTCTGGACATGCACCCGGCAAGG + Intronic
1106673295 13:31930624-31930646 GAATGCACATGCACCTGGCAAGG + Intergenic
1110329111 13:74250998-74251020 GTCAGGACAGGCAGCAGGCATGG - Intergenic
1114563125 14:23607714-23607736 GTCTGAACATGGGCCAGGCAAGG - Intergenic
1114617897 14:24077879-24077901 GTCAGGACAGGCACCTGGGAGGG - Exonic
1115506351 14:34097758-34097780 GTCTGGAAATGCAGCCAGCAGGG - Intronic
1121423874 14:93834487-93834509 GCCTGGACTTGGACCCCGCAAGG + Intergenic
1125272364 15:37953109-37953131 CTCTGGACATGCACAGGGCCAGG + Intronic
1127504511 15:59584771-59584793 GTCTGGTCATGGGCCGGGCATGG + Intergenic
1130994021 15:88894386-88894408 GTGCGGACATGCACCTGGCAGGG - Intronic
1136718342 16:32302050-32302072 GCCAGGACAAGCACCTGGCAGGG + Intergenic
1136836716 16:33508320-33508342 GCCAGGACAAGCACCTGGCAGGG + Intergenic
1136993129 16:35169431-35169453 GGCTGAACAAGCACCCAGCAGGG + Intergenic
1140786108 16:78343687-78343709 GTATGGATATGCACCCGGCTAGG + Intronic
1142279566 16:89140683-89140705 GTCAGGACATCCCCCCGGCCAGG + Intronic
1203008086 16_KI270728v1_random:215715-215737 GCCAGGACAAGCACCTGGCAGGG - Intergenic
1144368365 17:14567157-14567179 GTATGGACTTGCGCCGGGCATGG - Intergenic
1146419656 17:32671228-32671250 GTTTGGTCATGGACCCTGCATGG + Intronic
1161134863 19:2613711-2613733 GCCTGGAGGTGCTCCCGGCATGG + Intronic
1161135495 19:2617194-2617216 GACTGGAGATGCTCCTGGCATGG - Intronic
1163469229 19:17487079-17487101 GTCTGGGTATGCCCCGGGCAGGG + Intronic
1165435244 19:35791648-35791670 TTCTGGGCCAGCACCCGGCATGG - Intergenic
1168721190 19:58555825-58555847 GGCTGAACAAGCACCCAGCAGGG + Exonic
925870624 2:8266792-8266814 CTCTGGACATGCATGAGGCATGG - Intergenic
926060104 2:9799920-9799942 CCCTGGACATCCAGCCGGCAGGG + Intergenic
927149571 2:20187934-20187956 CTCTGGACAGGCACCTGGCTTGG - Intergenic
937325047 2:120985331-120985353 GCCCGGACAGGCACACGGCAGGG + Intronic
938765405 2:134457868-134457890 GACTGGAAAAGCACCCAGCAGGG - Intronic
947446983 2:230171831-230171853 GTCTAGACATGCACACGGATGGG + Intronic
947960266 2:234230411-234230433 ACCTGGCCATGCACCCTGCAAGG + Intergenic
948014960 2:234680860-234680882 ATCTGTACATGCACCCGGGAGGG - Intergenic
1172223151 20:33287306-33287328 GCTTGGACATGCACCCCTCATGG - Intronic
1175936154 20:62514983-62515005 GACAGGAAATGCACCAGGCAGGG + Intergenic
1176303202 21:5108661-5108683 GCCTGGACAGGCACCCAGCAGGG - Intergenic
1179853823 21:44153263-44153285 GCCTGGACAGGCACCCAGCAGGG + Intergenic
1179957879 21:44751330-44751352 GTCTGTTCCTGCACCCCGCAGGG + Intergenic
1180244890 21:46540351-46540373 GCCTGGAGAAGCACCCGGCCTGG + Intronic
1181584832 22:23847480-23847502 GGCTGGACAATCACCTGGCACGG - Intergenic
1181769846 22:25117412-25117434 GTGTGGTCATGCTCCCAGCAAGG - Intronic
950489256 3:13293392-13293414 ATCTGGAGATGCACACGGGAGGG - Intergenic
950740690 3:15049488-15049510 GTCTTTACATCCACCCAGCAAGG + Exonic
966082985 3:176028281-176028303 GTATGGGCATGAACCAGGCATGG + Intergenic
968503598 4:962011-962033 GCCTGGACTTCCACCAGGCACGG - Exonic
969197804 4:5576970-5576992 GTATCTGCATGCACCCGGCATGG + Intronic
969641725 4:8402767-8402789 CACTGGACATGCACGTGGCACGG + Intronic
971701673 4:29984992-29985014 TTCTGGACATGCACCGGGCCTGG + Intergenic
988919177 5:35925101-35925123 GTCTGCACATTCCCCCGGCCAGG + Intronic
1001526605 5:172433593-172433615 GGCTGGGCTGGCACCCGGCAGGG - Intronic
1003094036 6:3128498-3128520 GTCTGGACATGCGTTTGGCAGGG - Intronic
1011127681 6:84024261-84024283 GGCTGGATAAGCACCTGGCAAGG - Intergenic
1013831604 6:114279649-114279671 GTCAGGACATGGCCCCGGTATGG + Intronic
1019356866 7:584772-584794 TTCTGGAGAAGCTCCCGGCATGG + Intronic
1032797543 7:135289739-135289761 GTCTGGTTATGGACCCAGCATGG + Intergenic
1033218350 7:139510610-139510632 GTCAGGACAAGCACCAGGCCGGG - Intergenic
1034954918 7:155328142-155328164 GTCTGGACACACACCCGGGGTGG - Intergenic
1035017044 7:155775734-155775756 TGCTGGACAGGCACACGGCATGG + Exonic
1035353343 7:158261696-158261718 GTCTGGGCATGCACACCGCCAGG + Intronic
1035404550 7:158588660-158588682 GCCAGGACAGGGACCCGGCAGGG - Intergenic
1038286077 8:26207385-26207407 GTCTGGCCATGGGCCCTGCATGG + Intergenic
1040479429 8:47810056-47810078 GTCTGCACATGCACACTTCAGGG - Intronic
1040996553 8:53408229-53408251 GTGTGAACATCCACCCGGCGAGG - Intergenic
1041524421 8:58789371-58789393 GTGTGGGCATGGACCTGGCAGGG + Intergenic
1046975769 8:120275413-120275435 TTCTGGACATTGACCTGGCAAGG + Intronic
1047213848 8:122861470-122861492 TACTGGTCATGCACCCTGCATGG + Intronic
1048402667 8:134086500-134086522 CTCTGGACATGCCCCAGGCCAGG - Intergenic
1050237612 9:3598014-3598036 GTCTGGCCATGGACCCCACATGG + Intergenic
1051158741 9:14181802-14181824 GTCTAGACATGCACCCCTCAAGG + Intronic
1061804571 9:133130963-133130985 GACTGGGCATCCACCCGGCCAGG - Intronic
1203791212 EBV:152724-152746 GTCTGGAAGTCCACCAGGCAGGG - Intergenic
1186831878 X:13399007-13399029 TTCTGGACATGCACCCAGGCAGG - Intergenic
1187143819 X:16619570-16619592 GGCTGGACAGGCTCCAGGCATGG - Intronic