ID: 1102202383

View in Genome Browser
Species Human (GRCh38)
Location 12:111066581-111066603
Sequence ACCCATTGGGTGAGGGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 229}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102202372_1102202383 27 Left 1102202372 12:111066531-111066553 CCTTACCTCTGCCTGGAGCTGGA 0: 1
1: 0
2: 1
3: 30
4: 341
Right 1102202383 12:111066581-111066603 ACCCATTGGGTGAGGGGTGAGGG 0: 1
1: 0
2: 3
3: 19
4: 229
1102202375_1102202383 2 Left 1102202375 12:111066556-111066578 CCAGTTCAGCCAACGTTTGTTAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1102202383 12:111066581-111066603 ACCCATTGGGTGAGGGGTGAGGG 0: 1
1: 0
2: 3
3: 19
4: 229
1102202376_1102202383 -7 Left 1102202376 12:111066565-111066587 CCAACGTTTGTTAAGCACCCATT 0: 1
1: 0
2: 2
3: 11
4: 130
Right 1102202383 12:111066581-111066603 ACCCATTGGGTGAGGGGTGAGGG 0: 1
1: 0
2: 3
3: 19
4: 229
1102202374_1102202383 16 Left 1102202374 12:111066542-111066564 CCTGGAGCTGGAGTCCAGTTCAG 0: 1
1: 0
2: 3
3: 47
4: 523
Right 1102202383 12:111066581-111066603 ACCCATTGGGTGAGGGGTGAGGG 0: 1
1: 0
2: 3
3: 19
4: 229
1102202373_1102202383 22 Left 1102202373 12:111066536-111066558 CCTCTGCCTGGAGCTGGAGTCCA 0: 1
1: 0
2: 2
3: 32
4: 357
Right 1102202383 12:111066581-111066603 ACCCATTGGGTGAGGGGTGAGGG 0: 1
1: 0
2: 3
3: 19
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102202383 Original CRISPR ACCCATTGGGTGAGGGGTGA GGG Intronic
904014522 1:27409612-27409634 ACTGATTGGGGGATGGGTGAGGG - Intronic
904333712 1:29784036-29784058 ACCCATGTGGTGAGGGAGGAGGG - Intergenic
910473310 1:87578610-87578632 ACCCCTTGGTGAAGGGGTGAGGG + Intergenic
913124097 1:115769322-115769344 AGCCACTGGGCGAGGGGTGCAGG + Intergenic
914917215 1:151826140-151826162 ACCCCTTGGGGGTGGGGTGGGGG - Intronic
914938735 1:152003456-152003478 AGGGATTGGGTGAGGGATGAGGG + Intergenic
916563630 1:165954566-165954588 AACCCCTGGGTGAGGGCTGATGG + Intergenic
917507692 1:175643067-175643089 ATCTATTGGGTGAGAGGTGAAGG + Intronic
919879961 1:201894891-201894913 ACACCTTGGGTGAGGGGAGAAGG + Intergenic
920702659 1:208229619-208229641 ACCCACTGGGTGAGGCTAGATGG + Intronic
920856637 1:209668112-209668134 ACCCAGAGAGTGAGGGTTGAGGG + Intergenic
921700465 1:218263430-218263452 ACCTATTGGGTGAGGGCTGGTGG + Intergenic
923752798 1:236761920-236761942 ACCCATGGGGTGAGGGTGGATGG + Intronic
924274351 1:242370403-242370425 ACCTTACGGGTGAGGGGTGAGGG + Intronic
1065391068 10:25182003-25182025 ACGCATTGGGCTAGGTGTGATGG - Intronic
1066223443 10:33358234-33358256 GCCTATTGGGTGAGGGGCGGTGG - Intergenic
1066585817 10:36933937-36933959 ACACTTTGGTTGAGGGGTGGGGG + Intergenic
1067054388 10:43042587-43042609 GCCCACTGGGAGATGGGTGAGGG - Intergenic
1073100062 10:101001806-101001828 ACCCAATCGGTGAGGCCTGAAGG - Exonic
1073377639 10:103050609-103050631 AACCCTTGGGTCAGGGGTGGAGG + Intronic
1074191219 10:111139363-111139385 ACCTTTGGGGTGAGGGGTAAGGG + Intergenic
1074491490 10:113943251-113943273 ACCCAAAGGCTGTGGGGTGATGG - Intergenic
1074544208 10:114389847-114389869 CTCCATAGGGTGAGGGGTGGTGG + Intronic
1074868383 10:117558289-117558311 ACCCATGGGGGTAGGGGTGGGGG - Intergenic
1076364794 10:129914806-129914828 ACCCGTTGGGTGCAGGGAGAAGG - Intronic
1076976437 11:176076-176098 ATGGTTTGGGTGAGGGGTGAGGG - Intronic
1080828109 11:35865325-35865347 ACCCCTTGGGTTAGGGGTTGGGG - Intergenic
1083718501 11:64592452-64592474 AACCTCTGGGAGAGGGGTGAGGG + Intronic
1084166296 11:67376239-67376261 CCCCACTAGGTGAGGGGAGAGGG - Intronic
1084210531 11:67619400-67619422 ACCCAAGGGGTGAGGAGTGCGGG + Intergenic
1085581435 11:77654209-77654231 ACCAATTGGGTCAGGTGTGGTGG + Intergenic
1087666719 11:101057714-101057736 ATTTATTGGGTAAGGGGTGAAGG + Intronic
1089458315 11:118638619-118638641 ACCCATTGGTTGTAGGGTAAGGG + Intronic
1090360294 11:126167646-126167668 AACCAGTGGGTGAGGGGTGAGGG - Intergenic
1091262717 11:134246592-134246614 ACCTATAGGGAGAGGGGTAAAGG - Exonic
1091990447 12:4951191-4951213 ACCCAGTGGGTGCGATGTGAAGG + Intergenic
1092078484 12:5693122-5693144 ACCCATTGGGTGAGCTGACAAGG + Intronic
1092236061 12:6810399-6810421 ACCAATTGCGTTTGGGGTGATGG + Intronic
1096838932 12:54369544-54369566 ACCCCTTGGGCGATGGGTGCTGG + Exonic
1097695615 12:62772560-62772582 ACCCCTAGTCTGAGGGGTGAAGG + Intronic
1098041261 12:66355957-66355979 TGGCCTTGGGTGAGGGGTGAGGG - Intronic
1098279700 12:68849995-68850017 AACCCTTGGCTGGGGGGTGATGG + Exonic
1101410396 12:104462991-104463013 TTCCGTGGGGTGAGGGGTGAGGG + Intronic
1101916571 12:108900573-108900595 ATTCATTGGCTGAGGGGAGAAGG - Exonic
1102202383 12:111066581-111066603 ACCCATTGGGTGAGGGGTGAGGG + Intronic
1102646411 12:114406690-114406712 CCCCACTGGGTGGGGGGTGAGGG - Intronic
1106131999 13:26948585-26948607 TTCCAGAGGGTGAGGGGTGAGGG - Intergenic
1107836180 13:44413938-44413960 ACCCAAGGGCTGAGGAGTGAGGG + Intergenic
1109570557 13:64183447-64183469 ATCCATTGAATGTGGGGTGAGGG - Intergenic
1110368319 13:74712480-74712502 ACCCCTTGGGGGAGAGGTGGGGG - Intergenic
1110745940 13:79053589-79053611 ACCTTTTGGGAGATGGGTGAAGG - Intergenic
1110987253 13:81986146-81986168 ACTCATTGAGTGGGTGGTGATGG - Intergenic
1112591495 13:100767396-100767418 AGCAAATGGGTGTGGGGTGAAGG + Intergenic
1115944605 14:38645238-38645260 ACCCATTGGGTGAGTGGTCTTGG + Intergenic
1119878071 14:78077200-78077222 TCCCATGGGGTGAGGGGAAAAGG + Intergenic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1121641304 14:95486364-95486386 AGACATTGGGAGAGGGGTGGGGG - Intergenic
1121968621 14:98335436-98335458 TCTCATTGGGTGAGGGGAGATGG + Intergenic
1122852454 14:104544052-104544074 CCCCATTTGATTAGGGGTGATGG - Intronic
1123988832 15:25668323-25668345 ACCCAGTGGGTGAGAGCAGACGG + Intergenic
1124249535 15:28097759-28097781 TCCCAGTTGGTGATGGGTGATGG - Intronic
1126324565 15:47462814-47462836 TCACCTTGGGTGAGGGGAGAAGG + Intronic
1127226113 15:56931072-56931094 ATCCCTGGGGTGGGGGGTGAAGG - Intronic
1127328086 15:57914967-57914989 ACCGACTGGGGGAGAGGTGAAGG + Intergenic
1140410974 16:74740144-74740166 ACACAGTGGGTGAGGGAAGAGGG + Intronic
1141465680 16:84204612-84204634 ACCCAAGGGCTGAGGAGTGAGGG - Intergenic
1141753507 16:85975593-85975615 AACCCCAGGGTGAGGGGTGAGGG + Intergenic
1142683052 17:1561805-1561827 AGGCATCGGGTGAGGGGTGGTGG - Intronic
1143662237 17:8332781-8332803 ACCCAGTGGCGGGGGGGTGAAGG - Intergenic
1146722119 17:35130862-35130884 CCCCACTGGGGAAGGGGTGATGG - Intronic
1147979962 17:44268235-44268257 ACCCAGTGGGAGCGGGGTGGGGG - Intergenic
1148901755 17:50883923-50883945 CCCCAGTGGGTGCAGGGTGACGG - Intergenic
1153766074 18:8376232-8376254 ACGCAGTGGGTGATGGGTGCAGG + Intronic
1153987558 18:10367093-10367115 TCCCCTTGGGAGAGGGGTGGAGG - Intergenic
1154047081 18:10916284-10916306 ACCCAAGGGCTGAGGGGTGCAGG - Intronic
1157041963 18:44050361-44050383 AACAATTGGTTGAGGGTTGAAGG + Intergenic
1158845016 18:61432664-61432686 ACCCCTAGGGGAAGGGGTGATGG + Intronic
1158889834 18:61862652-61862674 ACACGTGGGGTGAGGGGTGGGGG - Intronic
1159997339 18:74978925-74978947 AACCATCGGGAGAGGCGTGAGGG + Intronic
1161324010 19:3654385-3654407 ACCCACAGGGAGAGGAGTGAGGG + Intronic
1161675700 19:5647317-5647339 ATCCATTGGCTGAAGGCTGAAGG + Intronic
1162967184 19:14161502-14161524 ACCCACTGGGTGCGTGGTGAGGG + Exonic
1163090675 19:15017793-15017815 ACTCTTTGGGGGTGGGGTGAGGG - Intronic
1163578559 19:18124536-18124558 ACCCAGTGGGTGAGCTGGGAAGG + Intronic
1165313183 19:35040586-35040608 AGCCATGGGCTCAGGGGTGAGGG + Intronic
1167144988 19:47676145-47676167 ACCCCTTGGGGAAGAGGTGAGGG + Intronic
1167787010 19:51645373-51645395 ACCCAGGGGCTGAGGGGTGAGGG + Intronic
924967434 2:91353-91375 ACCCAATGGCTGAGGAGTGTGGG + Intergenic
925088635 2:1134721-1134743 ACCCAATGGCTGAGGAGTGCGGG - Intronic
927417719 2:22896337-22896359 GCCCATTTGGTGGGGGGTGGGGG - Intergenic
929546115 2:42856195-42856217 AGCCACAGGGTGAGGGGTGAGGG + Intergenic
930696722 2:54419207-54419229 GCCTGTTGGGTGGGGGGTGAGGG + Intergenic
933511406 2:83245963-83245985 ACCCAAGGGGTGAGGAGTGTGGG - Intergenic
933812688 2:86042905-86042927 AGTCAGTGGGTGAGGGATGAGGG - Intronic
934157796 2:89219367-89219389 GCCTGTTGGGTCAGGGGTGATGG - Intergenic
934159526 2:89235047-89235069 AGCCATTGGGTGGGGGGTGAAGG + Intergenic
934207752 2:89947384-89947406 AGCCATTGGGTGGGGGGTGAAGG - Intergenic
934209467 2:89963059-89963081 GCCTGTTGGGTCAGGGGTGATGG + Intergenic
941272596 2:163449252-163449274 ACCCATGGGGTGTGGTTTGAGGG + Intergenic
942650630 2:178163668-178163690 ACCCCAGGGGCGAGGGGTGAGGG + Intergenic
942757696 2:179361794-179361816 ATTCAAGGGGTGAGGGGTGAGGG + Intergenic
944647763 2:201796717-201796739 ACCCATTGTGTCAGGGGAAAGGG + Intronic
945024330 2:205605970-205605992 ACCCAGTTGGTGAGGAGGGATGG + Intronic
945465844 2:210170722-210170744 ACCCATTGGGGGTGTGGTGACGG - Intronic
945865919 2:215175417-215175439 ACAGATTGGGTAAGGGGTTAAGG + Intergenic
946575432 2:221070983-221071005 ACCTGTTGGGGGAGGGGGGAAGG - Intergenic
946923500 2:224603698-224603720 ACCCATGGGCTGAGGAGTGCGGG - Intergenic
947094641 2:226551855-226551877 ACACATTGGGTGTAGGGAGAGGG - Intergenic
947486563 2:230555300-230555322 ACCTGTTGGGGGTGGGGTGAGGG + Intergenic
947728148 2:232413139-232413161 AGCCAATGAGTGAGGGGTAAGGG + Intergenic
947737295 2:232462499-232462521 AGCCAATGAGTGAGGGGTAAGGG + Intergenic
948717071 2:239871913-239871935 CCCCAGTGGGTGGGGGGTCAGGG + Intergenic
949001947 2:241619945-241619967 AGTCATTGAGTGAGGGGTGAGGG + Intronic
1168780050 20:481486-481508 CCCAATTGGGTGGGGGGTGGGGG - Exonic
1169506041 20:6213014-6213036 ACCCATTGGGTTGGGGGTGGGGG - Intergenic
1174421466 20:50401731-50401753 AGAGATTGGGTGAGGGGAGAGGG + Intergenic
1175591936 20:60200321-60200343 CCCTATTGGGTGAGGAGGGATGG + Intergenic
1178339659 21:31775206-31775228 ATCCATTAGGTGAGGGGAGGGGG - Intergenic
1178404905 21:32316165-32316187 ACCCATTGCCTGCGGGGTGGAGG + Intronic
1178518464 21:33267390-33267412 ACCAGTTGGGTGATGGGTGGTGG + Intronic
1179149229 21:38795950-38795972 ACCCAGAGGATGAGGGCTGAGGG + Intergenic
1179588181 21:42387288-42387310 ACTCATTGGGTGGGGGGTGTTGG - Intronic
1181133483 22:20748465-20748487 ACCCAGTGGGAGAAGGGTGCTGG + Intronic
1181801842 22:25352801-25352823 AACCATGGGGTGAGAGGGGAGGG + Intronic
1181973472 22:26711375-26711397 AGCCATTGGTTGAGGGCTGGGGG + Intergenic
1183720773 22:39560192-39560214 ACACTTGGGGTGTGGGGTGAAGG - Intergenic
1184538151 22:45101532-45101554 ACAGAGTGGGTGAGGGGGGAGGG - Intergenic
1184555144 22:45228967-45228989 ATCTTTTGGGTGAGTGGTGATGG - Intronic
1184649477 22:45913071-45913093 ACCCATGGGTGGAGGGGAGATGG - Intergenic
1185189202 22:49423441-49423463 CCCCATTGTGTGTTGGGTGAAGG + Intronic
949668064 3:6364552-6364574 AGCCAGAGGGTGAGGGGTGAGGG + Intergenic
949926310 3:9044830-9044852 GCCCATTGGGTGAAGGAAGAAGG - Intronic
952355439 3:32579079-32579101 ACCCAAGGGCTGAGGAGTGAAGG + Intergenic
954264471 3:49461785-49461807 TGCAGTTGGGTGAGGGGTGAGGG - Intergenic
954638040 3:52082160-52082182 AGCCAGTGGGTGAGGAGGGAAGG + Intronic
956699606 3:71947506-71947528 ACTGATGGGGTGAGGGGTGGTGG + Intergenic
956700759 3:71956634-71956656 AGCCATTGGCTGAGGGCTGTAGG + Intergenic
957419599 3:79951367-79951389 ACCCAAGGGCTGAGGGGTGCGGG - Intergenic
958556361 3:95682716-95682738 CACGATTGGGTGAGGGGAGAGGG + Intergenic
958708084 3:97681843-97681865 ACTGATTGGGAGAGGGATGAAGG + Intronic
960170164 3:114451626-114451648 AACTAGTGGGTGAGGGGAGAAGG + Intronic
960986890 3:123286646-123286668 TCCCATGGGGTGAGGGGTGGTGG + Intronic
962013670 3:131419212-131419234 ACAGAAGGGGTGAGGGGTGAGGG + Intergenic
962680369 3:137793041-137793063 ACCTATTGGGTGAGAGTTGTTGG + Intergenic
964494208 3:157271111-157271133 CCTCATGGGCTGAGGGGTGAAGG + Intronic
964515037 3:157498632-157498654 ACTCATTGGATGAGAGCTGATGG - Intronic
964663763 3:159150386-159150408 TGCCATTGGCTGAGGGCTGAGGG + Intronic
966334798 3:178856139-178856161 GCCCATTGGGTGATGGGGAATGG - Intergenic
968364273 3:198173139-198173161 ATGGTTTGGGTGAGGGGTGAGGG + Intergenic
968364465 3:198173785-198173807 ATGGTTTGGGTGAGGGGTGAGGG + Intergenic
968364617 3:198174265-198174287 ATGGTTTGGGTGAGGGGTGAGGG + Intergenic
968502439 4:957173-957195 ACGCAGAGGGCGAGGGGTGAGGG - Intronic
969606104 4:8202999-8203021 AGCCATGGGGGCAGGGGTGATGG + Intronic
969676866 4:8619192-8619214 AGCCACGGGGTGATGGGTGATGG - Intronic
969961856 4:10952501-10952523 ACACATTGGATGTTGGGTGAGGG + Intergenic
972891717 4:43565064-43565086 AGCCATTGGGTGATGGAAGAGGG + Intergenic
973045447 4:45530817-45530839 ACCCAAGGGCTGAGGAGTGAAGG + Intergenic
973998616 4:56486062-56486084 ACCCTGTGGCTGAGGGATGATGG + Intronic
975300051 4:72779729-72779751 CCACAGTGGGTGAGTGGTGATGG - Intergenic
975942701 4:79667065-79667087 TCACAGTGGGTGAAGGGTGAAGG - Intergenic
976630163 4:87228315-87228337 AGCCATTGGTTCAGAGGTGACGG + Intronic
978285647 4:107073558-107073580 ACCCAAGGGCTGAGGAGTGAGGG + Intronic
979949453 4:126874451-126874473 ACCCAATGGCTGAGGAGTGCTGG - Intergenic
980715744 4:136626318-136626340 AGCCATGGGGTGGGGGGTGCAGG - Intergenic
981639774 4:146927492-146927514 ACCCATTGGTTTGGGGGTCATGG - Intronic
982792284 4:159606899-159606921 ACCCTTTGGTTGAGGGCTCAGGG + Intergenic
983135000 4:164068718-164068740 ACCCAAGGGTTGAGGAGTGAGGG + Intronic
984209668 4:176830420-176830442 ACTCATGGGGTGAGGGGAGGAGG + Intergenic
984220737 4:176971483-176971505 ACACATCAGGTGAGGGGTGCAGG - Intergenic
984862547 4:184253305-184253327 ACCCATGGGCTGAGGAGTGCAGG + Intergenic
985366464 4:189236670-189236692 ACCCAAGGGCTGAGGGGTGCGGG + Intergenic
986121202 5:4837898-4837920 ACCCAAGGGGTGAGGAGTGCGGG + Intergenic
986500260 5:8391012-8391034 TCAAATTGGGTGAGAGGTGAAGG + Intergenic
986917255 5:12636466-12636488 ACACATTGGGTTAGTGGTAATGG + Intergenic
987846185 5:23290381-23290403 ACACATTGGGTACAGGGTGATGG - Intergenic
989419560 5:41220855-41220877 GCCTATTGGGTCAGGGGAGAAGG - Intronic
989957991 5:50377195-50377217 ACCCAAGGGCTGAGGAGTGAGGG + Intergenic
992907009 5:81356730-81356752 ACCGATTGGCTGTGGGGAGAAGG - Intronic
993087892 5:83386470-83386492 GCCCATGGGGGGAGGGGGGAGGG + Intergenic
993110139 5:83646689-83646711 ACTCCTGTGGTGAGGGGTGAGGG + Intronic
994058511 5:95447218-95447240 TCCCATTGGGTAAGGTGTGCTGG - Intronic
995782739 5:115795367-115795389 AAACATTTAGTGAGGGGTGAAGG - Intergenic
997697484 5:135873050-135873072 ACCCATGGGCTGAGGGGCAAGGG + Intronic
998945036 5:147329893-147329915 AACCATTGGGTGAGTGCAGAAGG + Intronic
1000179127 5:158790662-158790684 ACCCATTGGGAGATGAGAGAGGG - Intronic
1004194220 6:13488807-13488829 ACCCATTTGGTGCCGGGAGAGGG + Intergenic
1005828409 6:29650616-29650638 TCCCATTTGGTGAGGGGGGAGGG + Intergenic
1006348797 6:33505186-33505208 ACCCATTAGGGGAGGGTGGAGGG - Intergenic
1007721298 6:43887017-43887039 ACCTACTTGGTGAGGGGTGTGGG - Intergenic
1009510747 6:64547721-64547743 ACCCAAGGGCTGAGGAGTGAGGG - Intronic
1009722451 6:67489858-67489880 ACACCTTTGGTTAGGGGTGAGGG - Intergenic
1009800777 6:68533755-68533777 ACCCAAGGGCTGAGGGGTGCAGG + Intergenic
1011277325 6:85643405-85643427 ACCCCTTGGGTTGGGGGTGGGGG + Intronic
1011629673 6:89311582-89311604 GGCCTTTGGGTGAGGGGTGAGGG + Intronic
1014499219 6:122165123-122165145 ACCCAAGGGCTGAGGGGTGCGGG - Intergenic
1015306783 6:131717410-131717432 GCCCTTGGGGTGAGAGGTGAGGG + Intronic
1016633216 6:146256415-146256437 ACACACTGGGGGAGGAGTGAAGG - Intronic
1018028097 6:159821289-159821311 ACCCCTTTCCTGAGGGGTGAGGG + Intergenic
1021447031 7:20744612-20744634 ATCCATGGGGGGAGGGGGGAGGG + Intronic
1021493808 7:21249937-21249959 ATACATTGGGAGAGGAGTGAGGG - Intergenic
1022254365 7:28641286-28641308 CCCCATCGGGTGATGGCTGAAGG + Intronic
1024200166 7:47098233-47098255 GCCCATGAGGTGAGAGGTGAGGG + Intergenic
1025249351 7:57341732-57341754 AAAGATTGGGTGAGGGGAGAGGG - Intergenic
1025833441 7:65074899-65074921 AACCGTTGGGTGAGGGGCGGTGG + Intergenic
1025903204 7:65764408-65764430 AACCGTTGGGTGAGGGGCGGTGG + Intergenic
1027419034 7:78002237-78002259 ACCCTCTGTGTTAGGGGTGAGGG + Intergenic
1029809573 7:103034239-103034261 ACCCAATGGCTGAGGAGTGTGGG - Intronic
1032854358 7:135822172-135822194 ACAGGTTGGGAGAGGGGTGAGGG - Intergenic
1033988218 7:147252159-147252181 AACATTTGGGTGAGGGGTGGTGG + Intronic
1034232841 7:149546186-149546208 ATCCACTGGGGTAGGGGTGAGGG + Intergenic
1034433812 7:151053658-151053680 GCCCCAGGGGTGAGGGGTGAGGG + Intergenic
1035037758 7:155906550-155906572 AGCCCATGGGTGATGGGTGATGG + Intergenic
1037506669 8:19537532-19537554 ACACTTTGAGTGAGGGGTAAAGG - Intronic
1038772047 8:30491894-30491916 CTCCATTGGGGGAGGGGTGGGGG - Intronic
1040954857 8:52969829-52969851 ACCCAATGGCTGAGGAGTGTGGG - Intergenic
1041636914 8:60155303-60155325 ACCCATTGTGGGAGGGGTTGGGG + Intergenic
1041742982 8:61176741-61176763 CTCCCTTGGCTGAGGGGTGAGGG - Intronic
1042832067 8:73041517-73041539 ACCCCTTGGGTGAGACATGAAGG + Intronic
1044606100 8:94049000-94049022 ACCCATTGGGGGCGAGGTGGGGG - Intergenic
1048851982 8:138654154-138654176 ATCCTCTGGGTGAGGGGTCAGGG + Intronic
1050108529 9:2190976-2190998 AGCCATTGGGAGACAGGTGAAGG + Intronic
1050794481 9:9521182-9521204 ACACATGGGGTCAGGGGTGAGGG - Intronic
1051656512 9:19386885-19386907 ACCCCTTGGGTCAGGGACGAAGG + Intergenic
1052785428 9:32823714-32823736 ACCCATGGGTTGAGGGTTCAGGG + Intergenic
1052988796 9:34506544-34506566 ACCTAGTGGGGTAGGGGTGAGGG + Intronic
1054968918 9:71061893-71061915 ACCCAAGGGGAGAGGGGTAATGG + Intronic
1056453073 9:86735281-86735303 ACCCAATGGGTGGAGGGAGATGG - Intergenic
1056608447 9:88107170-88107192 AACAATGGGGTGAGGGGTGGGGG + Intergenic
1056735992 9:89209723-89209745 ACCCAATGGCTGAGGAGTGCCGG + Intergenic
1058063696 9:100525756-100525778 ACTCATGGGGTGAGGGGGCAGGG - Intronic
1058547675 9:106078073-106078095 AGCCATTGGGACGGGGGTGAGGG - Intergenic
1059046710 9:110876969-110876991 GCCCATTAGGTGAGGTGTAATGG - Intronic
1059082219 9:111262160-111262182 ACATATTGGGTGGGGCGTGATGG + Intergenic
1059176863 9:112175604-112175626 ACCCCCGGGGAGAGGGGTGAGGG + Intergenic
1060293812 9:122329622-122329644 ACTTATTGGATGAGGGGAGAGGG - Intergenic
1061108718 9:128552302-128552324 GCGCAAGGGGTGAGGGGTGATGG - Intergenic
1061287842 9:129634291-129634313 ATCCAGTGGGTGATAGGTGAGGG + Exonic
1062100542 9:134726085-134726107 CCCCAGTGGTTGAGGGGTAATGG + Intronic
1062406540 9:136399588-136399610 AGCCCTTGGGAGAGGGGTGCGGG - Intergenic
1062526332 9:136979386-136979408 ATCCATGGGGTGGGAGGTGATGG + Intronic
1187499632 X:19828984-19829006 TTCCATTGGGTGAGGGGAGGAGG - Intronic
1188959486 X:36472540-36472562 ACACATTGGTTGAGGGTAGAAGG + Intergenic
1189774817 X:44461260-44461282 AACCAATGGGAGAGGGTTGAGGG + Intergenic
1189779977 X:44504971-44504993 ACCCAGTGTGTGCGGGGTGGGGG - Intergenic
1190729675 X:53217339-53217361 TGCCATTGGGTGAGGGTAGAGGG - Intronic
1192849813 X:74942829-74942851 CCCCATCTGGTGAGGGGGGATGG + Intergenic
1193708912 X:84856641-84856663 ACCCAAGGGCTGAGGAGTGAGGG - Intergenic
1195693698 X:107650539-107650561 AGACATTGGGTGGGGGGTGGGGG + Exonic
1195909548 X:109875891-109875913 ACCCAAGGGCTGAGGAGTGAGGG - Intergenic
1196589896 X:117474517-117474539 AGCCAGTGAGTGAGTGGTGATGG - Intergenic
1201469156 Y:14314814-14314836 ACCCAAGGGCTGAGGAGTGAGGG + Intergenic
1201738985 Y:17303634-17303656 CTCCCTTGGCTGAGGGGTGAGGG - Intergenic