ID: 1102202669

View in Genome Browser
Species Human (GRCh38)
Location 12:111068416-111068438
Sequence ACGCTTGTCAGCGAGTGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102202665_1102202669 5 Left 1102202665 12:111068388-111068410 CCAGCCGGCCGATTTCTGTCCTT 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1102202669 12:111068416-111068438 ACGCTTGTCAGCGAGTGCTGCGG 0: 1
1: 0
2: 0
3: 0
4: 49
1102202667_1102202669 -3 Left 1102202667 12:111068396-111068418 CCGATTTCTGTCCTTTGAAGACG 0: 1
1: 0
2: 0
3: 19
4: 219
Right 1102202669 12:111068416-111068438 ACGCTTGTCAGCGAGTGCTGCGG 0: 1
1: 0
2: 0
3: 0
4: 49
1102202664_1102202669 9 Left 1102202664 12:111068384-111068406 CCAGCCAGCCGGCCGATTTCTGT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1102202669 12:111068416-111068438 ACGCTTGTCAGCGAGTGCTGCGG 0: 1
1: 0
2: 0
3: 0
4: 49
1102202666_1102202669 1 Left 1102202666 12:111068392-111068414 CCGGCCGATTTCTGTCCTTTGAA 0: 1
1: 0
2: 3
3: 22
4: 248
Right 1102202669 12:111068416-111068438 ACGCTTGTCAGCGAGTGCTGCGG 0: 1
1: 0
2: 0
3: 0
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102202669 Original CRISPR ACGCTTGTCAGCGAGTGCTG CGG Intronic
903589389 1:24442661-24442683 AAGCTTGTCACTGAGTGCAGTGG + Intronic
906056012 1:42917319-42917341 ACGCTGGCCCGCTAGTGCTGTGG + Intergenic
907326528 1:53641966-53641988 ACTCTTGTCAGGGAGAGCTTCGG - Intronic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1068278694 10:54838372-54838394 AAGCATGTAAGCGAGTGCAGGGG - Intronic
1068881776 10:62057012-62057034 ACACTTTTCAGTGAGTGCTAAGG - Intronic
1072535748 10:96361382-96361404 AGCCTTGCCAGAGAGTGCTGGGG - Intergenic
1076160897 10:128243405-128243427 GGGCTTGTCAGTGAGTCCTGGGG - Intergenic
1101962636 12:109261388-109261410 ACCCTTGTTAGGGACTGCTGAGG + Intronic
1102202669 12:111068416-111068438 ACGCTTGTCAGCGAGTGCTGCGG + Intronic
1107649686 13:42532238-42532260 ACACTTGGCAGAGAGTGATGAGG + Intergenic
1107797783 13:44071607-44071629 ACTCTTGTCACCGGGTGCAGTGG + Intergenic
1114743333 14:25120448-25120470 AGGCTGGTCAGCAAGTGCTTGGG - Intergenic
1117080577 14:52148040-52148062 AAGCCTGTCAGGGAGTGTTGGGG + Intergenic
1119729246 14:76940468-76940490 ACGCTTTCCAGTGGGTGCTGTGG - Intergenic
1128750448 15:70145018-70145040 CAGCTTCTCAGCGGGTGCTGAGG + Intergenic
1133294097 16:4742132-4742154 AGGCTTGGCAGTGAGTGCTTAGG - Intronic
1137244014 16:46688583-46688605 GTGTTTGTCAGCGAGTTCTGGGG - Intronic
1141850319 16:86640646-86640668 ACGCCTGTCATCGATGGCTGAGG - Intergenic
1150160248 17:62891709-62891731 ACACTTTTCAGAGATTGCTGGGG + Intergenic
1150982595 17:70158912-70158934 ACGCTTTTCAGCGGAGGCTGTGG + Intergenic
1160892600 19:1387236-1387258 ACGCTTGTCAGGCACAGCTGAGG + Intronic
1163751352 19:19080115-19080137 AGGCTTGTCAGCCAGCACTGGGG + Intronic
1167831911 19:52030333-52030355 AAGCTTCTCAGAGAATGCTGAGG + Intergenic
925744883 2:7035271-7035293 ACGCTGCTCAGCACGTGCTGTGG - Intronic
929498020 2:42463674-42463696 TCGCTTGTCACCTAATGCTGGGG - Intronic
932626145 2:73297482-73297504 ACTCCTGACAGCGAGAGCTGAGG + Intergenic
937286691 2:120758486-120758508 TCTCTTGTGAGGGAGTGCTGGGG + Intronic
940307551 2:152242882-152242904 CTGCTTGTCAGACAGTGCTGAGG - Intergenic
1169355235 20:4899696-4899718 AAGCATGTCAGGTAGTGCTGTGG + Exonic
1170096577 20:12651909-12651931 ACTCTTGTGAGAGAGTGGTGCGG + Intergenic
1171348654 20:24486099-24486121 ACGCCTGTCACTGAGAGCTGGGG - Intronic
1174595563 20:51680591-51680613 AAGCTTGCCAGGCAGTGCTGAGG - Intronic
1177228953 21:18294208-18294230 ACGCTTGGCAGTGTCTGCTGTGG + Intronic
1182748494 22:32623840-32623862 ACGCTTCTCTGTGAGTGCCGAGG + Intronic
996614895 5:125429526-125429548 GTGCTTCTCAGTGAGTGCTGTGG - Intergenic
1018639361 6:165892337-165892359 ACTTTGGTCAGAGAGTGCTGGGG - Intronic
1019077314 6:169398076-169398098 ACCCTTGTGAGCCAGGGCTGTGG + Intergenic
1029330427 7:99849034-99849056 AGGCTTATCAGGGAGTGCAGCGG + Intronic
1031941088 7:127790201-127790223 ATCCTTGTCATCGAGTGGTGAGG + Intronic
1034193837 7:149230779-149230801 ACCCTTGTCAGTGGGGGCTGGGG - Intergenic
1038407117 8:27330366-27330388 ATGCTTGTGAGAGAGTGCTCAGG - Intronic
1039751302 8:40481408-40481430 AAGCTTCTCAGTGAATGCTGAGG + Intergenic
1041149538 8:54917056-54917078 ACCCTTGTCATGGAATGCTGAGG + Intergenic
1041659949 8:60391842-60391864 ACCCTAGTCAGGGAGTGGTGTGG - Intergenic
1053425371 9:38006676-38006698 GCGTTTGTCAGCGAGGGCTCAGG - Intronic
1059507740 9:114814954-114814976 CCACATGTCAGGGAGTGCTGTGG - Intergenic
1059540608 9:115126658-115126680 ACACTTGTCAAAGTGTGCTGTGG - Intergenic
1059762095 9:117347818-117347840 GCCCTTGTCATCCAGTGCTGGGG - Intronic
1196699689 X:118654524-118654546 AGGCTTGTCATCCAATGCTGAGG - Intronic