ID: 1102203741

View in Genome Browser
Species Human (GRCh38)
Location 12:111075855-111075877
Sequence TAGTCTCCATCAGACCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 82}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102203738_1102203741 3 Left 1102203738 12:111075829-111075851 CCACTCTGCCTAGGAAATGAGCA 0: 1
1: 0
2: 0
3: 30
4: 268
Right 1102203741 12:111075855-111075877 TAGTCTCCATCAGACCAAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 82
1102203737_1102203741 10 Left 1102203737 12:111075822-111075844 CCAGGTTCCACTCTGCCTAGGAA 0: 1
1: 0
2: 3
3: 15
4: 147
Right 1102203741 12:111075855-111075877 TAGTCTCCATCAGACCAAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 82
1102203734_1102203741 15 Left 1102203734 12:111075817-111075839 CCCTGCCAGGTTCCACTCTGCCT 0: 1
1: 1
2: 3
3: 33
4: 377
Right 1102203741 12:111075855-111075877 TAGTCTCCATCAGACCAAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 82
1102203733_1102203741 16 Left 1102203733 12:111075816-111075838 CCCCTGCCAGGTTCCACTCTGCC 0: 1
1: 0
2: 5
3: 33
4: 387
Right 1102203741 12:111075855-111075877 TAGTCTCCATCAGACCAAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 82
1102203735_1102203741 14 Left 1102203735 12:111075818-111075840 CCTGCCAGGTTCCACTCTGCCTA 0: 1
1: 0
2: 1
3: 18
4: 207
Right 1102203741 12:111075855-111075877 TAGTCTCCATCAGACCAAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 82
1102203739_1102203741 -5 Left 1102203739 12:111075837-111075859 CCTAGGAAATGAGCAAAATAGTC 0: 1
1: 0
2: 2
3: 32
4: 329
Right 1102203741 12:111075855-111075877 TAGTCTCCATCAGACCAAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102203741 Original CRISPR TAGTCTCCATCAGACCAAGT GGG Intronic
901180706 1:7339936-7339958 TTGTCTCCAGCAGACATAGTGGG + Intronic
901949146 1:12727515-12727537 GAGCCTCCAGAAGACCAAGTGGG - Exonic
904076495 1:27846764-27846786 TACTCTCCACCAGAGCAACTGGG + Intronic
905977569 1:42188914-42188936 TACTCTCCATCAGACCTATGAGG + Exonic
906518275 1:46452366-46452388 TAGCCACCATCAGACCACCTGGG - Intergenic
913342599 1:117773688-117773710 AAGTATCAATCAGACTAAGTTGG - Intergenic
920606905 1:207397835-207397857 TAGTCTGCATCACTCCTAGTAGG - Intergenic
921747391 1:218753598-218753620 TAGTGGCAATCAGCCCAAGTGGG + Intergenic
1068418647 10:56760639-56760661 TAATATCTATGAGACCAAGTAGG + Intergenic
1071375438 10:84997520-84997542 TTGACTTCATAAGACCAAGTGGG - Intergenic
1077073461 11:688789-688811 GAGTTTCCAACAGACCGAGTTGG + Intronic
1079026399 11:16951319-16951341 TACTCTCCATCAGTCTAAGAGGG + Intronic
1084604405 11:70164159-70164181 GGGGCTCCATCAGACCAAGCCGG + Intronic
1094170110 12:27482329-27482351 TCATCTCCATCAGCCCAAGCTGG + Intronic
1095646275 12:44551780-44551802 TGGGCTCCTTCAGTCCAAGTTGG - Intronic
1102203741 12:111075855-111075877 TAGTCTCCATCAGACCAAGTGGG + Intronic
1102293508 12:111720290-111720312 AAATGTCCATCAGATCAAGTTGG + Intronic
1103131341 12:118471279-118471301 TAGTCTCCACCAGCTCTAGTGGG - Intergenic
1104249007 12:127071973-127071995 CAGTCTCCATGAGATCAAGAAGG + Intergenic
1107490957 13:40879557-40879579 TGGTGGCCATCAGCCCAAGTAGG + Intergenic
1114951243 14:27756835-27756857 TAATCTCCATCATACCAGGCTGG + Intergenic
1117844501 14:59896900-59896922 TCCTCTCCATCAGCCCAACTTGG + Intergenic
1120557375 14:85945354-85945376 TGTGTTCCATCAGACCAAGTGGG - Intergenic
1121847734 14:97188092-97188114 TAGTCTCCTAAATACCAAGTAGG + Intergenic
1124902051 15:33833037-33833059 GAGTCTCCATAGGACCACGTAGG + Intronic
1125705370 15:41730220-41730242 TAGTCTCGATCAGCCCACCTCGG - Intronic
1130424390 15:83780495-83780517 CAGTCAACATCATACCAAGTGGG + Intronic
1135860836 16:26054520-26054542 CAGTGGCCAGCAGACCAAGTTGG + Intronic
1142467621 17:145266-145288 GAGTCTCCGACAGACCAAGAGGG + Intergenic
1148627601 17:49081693-49081715 TTGTCTCCTTCAGTCTAAGTTGG + Intergenic
1151571480 17:74928031-74928053 CAGTCTCCATCCCACCAAGAAGG + Intronic
1152375822 17:79918462-79918484 TGGCCTCCATCAGGACAAGTGGG + Intergenic
1168471184 19:56642499-56642521 TAGCCTCCATGAGAGCAACTTGG + Intergenic
930103435 2:47620222-47620244 TAGTCACCATCAGGACAAGGAGG + Intergenic
931951889 2:67373302-67373324 TTTTCTCCATCAGACTAAATTGG + Intergenic
932215752 2:69964912-69964934 TAGTCTCCCTCAGGCCAGTTGGG + Intergenic
932438904 2:71719478-71719500 CTGTCTCCATCAGTCCAAGCTGG + Intergenic
938221081 2:129568522-129568544 CAGTCTCTTTCAGACCAAGCTGG - Intergenic
940491448 2:154366977-154366999 TACTCTCCCTTAGACCAGGTTGG + Intronic
941189853 2:162367968-162367990 GATTCTGCATCAGACCAACTTGG - Intronic
948243951 2:236462322-236462344 AAGTCCCCAACAGACCAGGTGGG + Intronic
1170348066 20:15408921-15408943 TAGTTGCCACCAGATCAAGTTGG + Intronic
1181641418 22:24201942-24201964 TAGTAACCATCACACCAAGGCGG - Intergenic
949672574 3:6416741-6416763 TAGTCTGCATGAGACCCAGGAGG - Intergenic
956987435 3:74718241-74718263 TTGACTCTATTAGACCAAGTAGG + Intergenic
957714571 3:83908788-83908810 TATTCTCCTTCAGACAATGTAGG + Intergenic
957733875 3:84180744-84180766 TTCTCTCCACCAGGCCAAGTGGG - Intergenic
963958525 3:151282166-151282188 AAGTCTCCAAGAGAGCAAGTGGG - Intronic
973536705 4:51890302-51890324 TAGCCGCCATCTGACCCAGTTGG + Intronic
975909690 4:79252223-79252245 TAGTATCCATCGTACCCAGTAGG - Intronic
978288199 4:107104174-107104196 CACTCTCCATCACACCAACTTGG + Intronic
978757570 4:112320152-112320174 TAGTCAACATCATACCAAATGGG - Intronic
984158499 4:176223076-176223098 TAGCCTCAATCAAAACAAGTTGG - Intronic
986577967 5:9232082-9232104 TTGTGTCCTTGAGACCAAGTGGG - Intronic
987309272 5:16667025-16667047 CAGTTTCCATCAAGCCAAGTTGG - Intronic
990087923 5:52001673-52001695 TAGTCTCCATCATAGCCTGTGGG + Intergenic
997621936 5:135304833-135304855 TAGTCTCCATTTGACCCAGGAGG + Intronic
998134086 5:139665595-139665617 CTGTCTCCATCAGCCCAAGCTGG - Intronic
1010724005 6:79312783-79312805 TTCTCTGTATCAGACCAAGTGGG + Intergenic
1012250011 6:96969538-96969560 TAGTCTCCACTAGACAACGTAGG - Intronic
1014720846 6:124916470-124916492 TACTCTACATCACACAAAGTAGG - Intergenic
1024693476 7:51828926-51828948 GAGTCTATATCAGAGCAAGTTGG - Intergenic
1025094826 7:56088802-56088824 TAGGCTCCAGCAGACCCTGTGGG - Intronic
1025474401 7:60901405-60901427 CAGTCTGCATCATATCAAGTTGG + Intergenic
1025512602 7:61588469-61588491 CAGTCTGCATCATATCAAGTTGG - Intergenic
1026693117 7:72567216-72567238 TGGTCACCATCTGACCAAGATGG + Intronic
1028356719 7:89919065-89919087 AAGTCTCCAAGAGACCAAGATGG - Intergenic
1028509893 7:91612633-91612655 TAGCCTCCCTCAGAATAAGTGGG - Intergenic
1030905523 7:115176567-115176589 TAGGCTCCTGGAGACCAAGTGGG + Intergenic
1032125728 7:129191222-129191244 TAGTTACCATCAGATCAAGGAGG + Intronic
1034302168 7:150025818-150025840 CAGTCTGCATCAGACTAAGATGG - Intergenic
1034725126 7:153328827-153328849 TATTCTCCACCAGAAGAAGTCGG - Intergenic
1034803889 7:154071501-154071523 CAGTCTGCATCAGACTAAGATGG + Intronic
1035332215 7:158103720-158103742 TGGTGTCCATCACATCAAGTGGG - Intronic
1037756599 8:21714167-21714189 TATTCTACATCAGACAAATTTGG - Intronic
1041571532 8:59342944-59342966 TAGCCTCCAGCAGAGTAAGTGGG - Intergenic
1041885873 8:62806886-62806908 TTGTCTACATGAGACCAAGCAGG + Intronic
1042367534 8:67953560-67953582 TATTTTCCTTCAGACCAAGGGGG - Intronic
1044091001 8:88001297-88001319 TAGGCTCCAACAGAGGAAGTTGG + Intergenic
1046848354 8:118944224-118944246 GAGTCTTCAGCAGACCAACTAGG - Intronic
1052198775 9:25751623-25751645 TAGTCATCAGCAGACCAACTGGG + Intergenic
1052359928 9:27542812-27542834 TACTTTTCATCAGACCAATTAGG - Intergenic
1058824120 9:108759522-108759544 TATTCCCTATCAGACCAAGAAGG + Intergenic
1195525380 X:105883131-105883153 TTATATCCATCAGACCAAGTGGG - Intronic