ID: 1102203791

View in Genome Browser
Species Human (GRCh38)
Location 12:111076363-111076385
Sequence CTAGGTCATCTCTACATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102203791_1102203795 20 Left 1102203791 12:111076363-111076385 CCTACCATGTAGAGATGACCTAG 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1102203795 12:111076406-111076428 GCATTCTTGTTCCCATTTGATGG 0: 1
1: 0
2: 1
3: 28
4: 249
1102203791_1102203796 26 Left 1102203791 12:111076363-111076385 CCTACCATGTAGAGATGACCTAG 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1102203796 12:111076412-111076434 TTGTTCCCATTTGATGGATGAGG 0: 2
1: 3
2: 53
3: 367
4: 1883

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102203791 Original CRISPR CTAGGTCATCTCTACATGGT AGG (reversed) Intronic
1063457948 10:6197819-6197841 CAAGGTCAACTGTATATGGTTGG + Intronic
1069702205 10:70435122-70435144 CTCGGTCATCTCTACATGCCTGG + Intronic
1071047697 10:81402565-81402587 CTAGGACACCTCTAGATGATAGG - Intergenic
1072736092 10:97880628-97880650 CTAGGTGATCTCTTCATGCATGG + Intronic
1075179254 10:120195696-120195718 TTAGGTGATCTCTAGATGCTTGG + Intergenic
1075994732 10:126868162-126868184 CTGGGTCATCCCAACTTGGTGGG - Intergenic
1080152298 11:29067212-29067234 CTAGGTCTTCTTTATATGTTTGG - Intergenic
1080407832 11:31995464-31995486 CTAGGTAATCTCATCATGTTGGG + Intronic
1080443339 11:32315002-32315024 TTAAGTCATCTCTACATTGCAGG + Intergenic
1081006431 11:37749464-37749486 CTAGTTCTTCTCTACATGTTGGG - Intergenic
1085462879 11:76705683-76705705 CAAGGTCACCTCTGCATGGAAGG + Intergenic
1087543696 11:99555187-99555209 CTAGGTTATCTCTATATTTTAGG - Intronic
1087688409 11:101291236-101291258 CTAGATCATCTCTGCATGAGAGG - Intergenic
1090027763 11:123182331-123182353 CGAGGTCATCACCACAGGGTAGG + Intronic
1091700578 12:2657301-2657323 TTATGTTATCTCTACAAGGTAGG + Intronic
1101455482 12:104826412-104826434 CTAGGTCAATCCTACATTGTCGG - Intronic
1101458142 12:104859196-104859218 CAAGGCCCTCTGTACATGGTTGG - Intronic
1102203791 12:111076363-111076385 CTAGGTCATCTCTACATGGTAGG - Intronic
1105047654 12:133018966-133018988 GTATGTCTTCTGTACATGGTTGG - Exonic
1108230516 13:48335053-48335075 CACGATTATCTCTACATGGTAGG - Intronic
1110618304 13:77566334-77566356 CTAGAACATCCCTACAAGGTAGG - Intronic
1114926840 14:27412704-27412726 CTAGGCCATATCTACCTAGTCGG + Intergenic
1117336315 14:54759905-54759927 CGTGGTCATCTCTAGATAGTGGG + Intronic
1119970818 14:78968169-78968191 CCAGGTGATCTCTATATGGCTGG + Exonic
1125266302 15:37885267-37885289 CAAGGTCATCTATACTTGGGAGG + Intergenic
1126576816 15:50205510-50205532 CTAAGTCCCCTCTATATGGTAGG - Intronic
1127934608 15:63624890-63624912 ATGGGGCATCTCTATATGGTAGG - Intronic
1128189124 15:65673675-65673697 CTAGGGTGTCTCTACATGGTAGG - Intronic
1135059129 16:19255925-19255947 CTAGATCATCTCCACATACTGGG + Intronic
1135120327 16:19760903-19760925 CTAGATCATCTAAACATGGGAGG - Intronic
1137314472 16:47301990-47302012 CAAGGTCACATCTATATGGTTGG - Intronic
1138045550 16:53720422-53720444 CTTGATAATTTCTACATGGTGGG - Intronic
1146414127 17:32616116-32616138 CTAGATCATCACTGCATGTTGGG + Intronic
1148701397 17:49589131-49589153 CTGGGTTATCGGTACATGGTTGG - Intergenic
1152510805 17:80786268-80786290 CTAAGCTATCTCAACATGGTGGG + Intronic
1156892046 18:42202436-42202458 TTAGGCCATGTCTACATTGTTGG - Intergenic
1165230327 19:34382725-34382747 CTAACTCATCTCTACATGCTGGG - Intronic
1166217237 19:41343651-41343673 CTAGGTCATTCCTGCCTGGTGGG + Intronic
925753223 2:7108721-7108743 CTAGGTCAGCTATTCATGGATGG - Intergenic
926830188 2:16953457-16953479 CTATGTCATTTCTACTTGTTTGG + Intergenic
928879616 2:36083509-36083531 AAAGGTCATCATTACATGGTGGG - Intergenic
940478214 2:154193396-154193418 TTAGGTCATCTCTCCTTGGGGGG + Intronic
942715958 2:178892412-178892434 CTAGGTCATCTCTGTCTGATTGG + Intronic
943379388 2:187124685-187124707 ATAGTTCATTTCTACATGGACGG + Intergenic
946336894 2:219043668-219043690 CTGGGTCTTCTCTATATGATGGG - Intergenic
947096195 2:226569989-226570011 ATAGGTCATGGGTACATGGTAGG - Intergenic
1170782520 20:19438450-19438472 ACAGGACATCCCTACATGGTAGG + Intronic
1171415948 20:24980493-24980515 CTCGGTCACCTCTACACGCTGGG + Intronic
1173646271 20:44635012-44635034 CTAGGTCATCTCTCTAGGGAGGG + Intronic
1177815768 21:25974865-25974887 CAAGGTCATCTCTACACAGCAGG - Intronic
1179618702 21:42598523-42598545 CTAGGTGGTCTCTCCATTGTGGG - Intergenic
1185028002 22:48426507-48426529 CGAGGCCATCTGTCCATGGTGGG + Intergenic
949923794 3:9024671-9024693 CTAGGTCACCTCTCCAGGGTTGG + Intronic
954791707 3:53137873-53137895 TTAGTCCATCTCTAAATGGTAGG - Intergenic
955488818 3:59462200-59462222 CAAGGTTATCTTTACATGGCAGG - Intergenic
961108214 3:124260386-124260408 CTAGCTCAGCCCTACATGGCAGG + Intronic
962231255 3:133667481-133667503 CTAGATCTTTTCCACATGGTCGG - Intergenic
966622353 3:181979481-181979503 CTATGACAACTCTACAAGGTAGG - Intergenic
967707200 3:192664927-192664949 CTAGTTCTTCTCTACTGGGTAGG - Intronic
969512376 4:7626196-7626218 CTAGGTCATCTATGAATGGTCGG - Intronic
969983976 4:11188045-11188067 CTAGGTCAGCTGTACCTGGTGGG - Intergenic
971313813 4:25550080-25550102 CAAGGTCATCTCAAGATGGCAGG - Intergenic
972094298 4:35329297-35329319 CCAGGTAATCTCTTCAGGGTTGG + Intergenic
972204948 4:36760371-36760393 CTATGTAATCTCTAGATGGCAGG - Intergenic
973951327 4:56017485-56017507 ATAGGTCATCTTTAAATAGTAGG + Intronic
978227945 4:106361170-106361192 CTAGGCATGCTCTACATGGTAGG + Intergenic
983856072 4:172647051-172647073 CTAGGAAACCTCTACAGGGTGGG - Intronic
984600942 4:181726297-181726319 CTCTGACATTTCTACATGGTAGG - Intergenic
987221081 5:15791211-15791233 GTAGGTATTCTATACATGGTAGG + Intronic
987560793 5:19517095-19517117 TTAGGTCATTTCTACATCATTGG - Intronic
990157257 5:52891799-52891821 TTAGGTCATATCTACATATTGGG + Intronic
992458237 5:76936411-76936433 CATGGTTATATCTACATGGTAGG + Intergenic
1000851327 5:166343291-166343313 CTATGTCCTCTCTAAATGGCAGG + Intergenic
1001987932 5:176091550-176091572 AGAGGTCATCTTTAAATGGTAGG + Intronic
1002228938 5:177746591-177746613 AGAGGTCATCTTTAAATGGTAGG - Intronic
1002266409 5:178037192-178037214 AGAGGTCATCTTTAAATGGTAGG + Intronic
1003396233 6:5754819-5754841 CAAGGTCATCTCTTCATCTTGGG + Intronic
1005419548 6:25634760-25634782 CTATGTCATCTGTACAGGATGGG - Intergenic
1006518086 6:34555706-34555728 CTGGGCCAACTCTACATGCTGGG - Intronic
1007456161 6:41978749-41978771 ATTGGTCATCTCTATATGGGTGG + Intronic
1008347391 6:50444406-50444428 CTATGTCATCCCTACAAAGTGGG - Intergenic
1011945511 6:92896815-92896837 CTAGGGCATCGCTAGGTGGTAGG - Intergenic
1013509631 6:110832569-110832591 ATAGGTCTTGTCTACAAGGTTGG - Intronic
1014142574 6:117961348-117961370 CCTGGTCATCTCTACAGGATGGG + Intronic
1016806609 6:148218360-148218382 CTCTGTCATCTTTACATGTTAGG - Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1022421211 7:30225275-30225297 CTGGGTCATTTCTACTTGTTAGG - Intergenic
1028676212 7:93464870-93464892 CTACGTCATCTCTACATATTGGG - Intronic
1029632516 7:101761938-101761960 GTAGGTCATTTCTTCCTGGTGGG + Intergenic
1033800483 7:144895926-144895948 CTATGACATCACTAAATGGTAGG + Intergenic
1046318440 8:112537792-112537814 TTAGGTCTTCTCTAAATGTTTGG - Intronic
1046376019 8:113381814-113381836 ATAGGTTATCTCTGTATGGTGGG - Intronic
1047688623 8:127327879-127327901 CTAGGTCATCTCTAGGTCCTAGG + Intergenic
1048281047 8:133105967-133105989 CAAGAGCATGTCTACATGGTGGG - Intronic
1051122761 9:13769836-13769858 TTAGGTCATCAGTATATGGTAGG + Intergenic
1052983475 9:34466978-34467000 CTAGCTCATCTGTTCATGCTAGG + Intronic
1054703714 9:68440434-68440456 CAAGGACATCTCTAAATGCTTGG + Intronic
1054792560 9:69269561-69269583 ATAGGTCCTCTCTAACTGGTGGG + Intergenic
1058822550 9:108745962-108745984 CTAGCTCTTCTCTACCTGGTGGG + Intergenic
1059049288 9:110905270-110905292 CTAGGTCATATATGGATGGTTGG + Intronic
1061342055 9:129990418-129990440 ATAGGTGATATCTACATGGAAGG + Intronic
1185444849 X:252452-252474 CAAGGTGATCTCTACATGTTTGG + Intergenic
1185444945 X:252953-252975 CAAGGTGATCTCTGCATGTTTGG + Intergenic
1186154138 X:6708129-6708151 TTAGGGCATCTCTCCTTGGTTGG - Intergenic
1188642805 X:32527427-32527449 GTAGGTCATCTTCAAATGGTTGG - Intronic
1189957319 X:46288765-46288787 CTGGGTCATCTTCTCATGGTTGG + Intergenic