ID: 1102205000

View in Genome Browser
Species Human (GRCh38)
Location 12:111084192-111084214
Sequence CTGAATCAGCAGGAGTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 7, 3: 66, 4: 552}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102204996_1102205000 1 Left 1102204996 12:111084168-111084190 CCTCCTGGTCTACAGCGGTGAAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1102205000 12:111084192-111084214 CTGAATCAGCAGGAGTGGAGTGG 0: 1
1: 0
2: 7
3: 66
4: 552
1102204993_1102205000 23 Left 1102204993 12:111084146-111084168 CCTTACAAATAAATATGATTTTC 0: 1
1: 0
2: 5
3: 38
4: 672
Right 1102205000 12:111084192-111084214 CTGAATCAGCAGGAGTGGAGTGG 0: 1
1: 0
2: 7
3: 66
4: 552
1102204997_1102205000 -2 Left 1102204997 12:111084171-111084193 CCTGGTCTACAGCGGTGAAGACT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1102205000 12:111084192-111084214 CTGAATCAGCAGGAGTGGAGTGG 0: 1
1: 0
2: 7
3: 66
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102205000 Original CRISPR CTGAATCAGCAGGAGTGGAG TGG Intronic
900423923 1:2567590-2567612 TTGAAGGCGCAGGAGTGGAGGGG - Intergenic
900749768 1:4387964-4387986 CTGGAGCAGCATGAGTGGTGGGG + Intergenic
900761798 1:4477441-4477463 CTTTTGCAGCAGGAGTGGAGTGG + Intergenic
900899880 1:5509196-5509218 CTGACTCAGCAGGTGTGGGGCGG - Intergenic
901080660 1:6581995-6582017 ATGAATCAGCAGGAGTTGTAGGG - Intronic
901333947 1:8432316-8432338 TTGAATAAGCAGAAGTGAAGAGG - Intronic
901409885 1:9075408-9075430 CGGTATCAGCAGAAGAGGAGCGG - Intronic
902007823 1:13246206-13246228 CTGGCTCAGGAGGAGTGGTGGGG + Intergenic
902015772 1:13306298-13306320 CTGGCTCAGGAGGAGTGGTGGGG + Intronic
902026801 1:13390001-13390023 CTGGCTCAGGAGGAGTGGTGGGG + Intronic
902182040 1:14696711-14696733 CTGATTCAGCAGGTCTGGGGTGG + Intronic
902186135 1:14726786-14726808 CTGATTCAGCAGGTCTGGGGCGG - Intronic
902490109 1:16775348-16775370 CAGAAGCAGCAGGAGGGGCGTGG + Intronic
902714336 1:18262066-18262088 CTGATTCAGCAGGTCTGGGGCGG + Intronic
902753664 1:18535245-18535267 CTGAAGCAGCAGCAGTGAAAGGG - Intergenic
903234448 1:21940557-21940579 CTGAATTTGGAGGAGTGGACAGG - Intergenic
903259293 1:22122658-22122680 CTGTGTCCGCAGGAGCGGAGGGG + Intronic
903770171 1:25758800-25758822 ATGGATCAGCAGGAGGGCAGTGG + Intronic
903798829 1:25951326-25951348 CTGATTCAGAAGGTCTGGAGGGG - Intergenic
904046243 1:27610440-27610462 GTGAATCAGCAGGACAGAAGTGG - Intergenic
905036931 1:34924767-34924789 CTGAAACAGCAAAAGGGGAGAGG + Intronic
905358297 1:37400423-37400445 CTCAATAAACAGGAGTGGAGTGG + Intergenic
905816102 1:40952298-40952320 CTGATTCAGCAGGTCTGCAGTGG + Intergenic
906275549 1:44512705-44512727 CGGAGGCGGCAGGAGTGGAGAGG + Intronic
906350791 1:45057188-45057210 CTGAATTAGTAGGTTTGGAGTGG - Intronic
906953007 1:50349615-50349637 CTGAATGAGCTGGAGAAGAGTGG - Intergenic
907956116 1:59229986-59230008 ATGAACCAGCAGGACTGGAAGGG - Intergenic
908234076 1:62133708-62133730 CTGATTTTGCAGGAGTGGAGTGG + Intronic
909332981 1:74437226-74437248 CTGAAGCAGCAGGAAGTGAGAGG - Intronic
909806150 1:79875925-79875947 CTGCAGCTGCAGTAGTGGAGAGG - Intergenic
910895517 1:92065289-92065311 CTGAAACAGGAAGAGTGGCGTGG - Intergenic
911500592 1:98680244-98680266 CTGAAGCAGCTGGAGTGGCTGGG + Intronic
912959026 1:114178936-114178958 CTGATTCAGGAGGTCTGGAGCGG - Intergenic
913664059 1:121031249-121031271 CTGAATCAGCAGAAATGGCAGGG + Intergenic
914015451 1:143814528-143814550 CTGAATCAGCAGAAATGGCAGGG + Intergenic
914162333 1:145146480-145146502 CTGAATCAGCAGAAATGGCAGGG - Intergenic
914333708 1:146696804-146696826 CTGAACCAGATGGACTGGAGGGG + Intergenic
914357654 1:146901225-146901247 CTCAGTCAGCTGGAGTGCAGTGG + Intergenic
914381473 1:147120154-147120176 CAGAATCATCAGGAGTGAGGAGG + Intergenic
914654069 1:149723069-149723091 CTGAATCAGCAGAAATGGCAGGG + Intergenic
916592614 1:166206907-166206929 CTGACCCACCAGGAGAGGAGAGG + Intergenic
917729616 1:177861799-177861821 CTGAGTGAGGAGGAGTTGAGGGG - Intergenic
917923849 1:179772502-179772524 CTGAATCAGCAGATTTGGAATGG - Intronic
917981489 1:180272259-180272281 CCCAGTCAGCAGGAGGGGAGGGG - Intronic
918114866 1:181486916-181486938 CTGATTCAGCAGGATTGAAGTGG - Intronic
918872560 1:189994458-189994480 CTGACTCAGTAGGATTGGGGTGG - Intergenic
920234521 1:204494115-204494137 CTGAAGCTGCTGGAGTGGAGTGG + Intronic
920280542 1:204840123-204840145 CAGAATCAGCAGGTCTGGACTGG + Intronic
921476963 1:215622659-215622681 CAAATTCAGCAGGACTGGAGTGG - Intergenic
922208234 1:223467465-223467487 CTGTGGCAGCAGCAGTGGAGAGG + Intergenic
922566898 1:226606946-226606968 CTGGAACAGCAGGAGTGTGGAGG - Exonic
922689317 1:227675231-227675253 CAGGATGGGCAGGAGTGGAGGGG - Intronic
923036699 1:230289486-230289508 CTGATTCGGCAGGACTGGGGTGG + Intergenic
923168922 1:231395001-231395023 CTGATTCAGGAGGTCTGGAGTGG + Intronic
923530328 1:234807182-234807204 CAGAAGCAGCAGGAGGGGCGTGG - Intergenic
923738036 1:236630452-236630474 CTCAATCAGCTGGAGTGCAGAGG - Intergenic
923774245 1:236964265-236964287 CTCCATCAGCAGAAGTGAAGAGG + Intergenic
924300099 1:242628509-242628531 CTGAATCAGCTGGAAAGAAGTGG - Intergenic
924736614 1:246762920-246762942 CTGATTCAGTAGGTCTGGAGTGG + Intronic
1063688040 10:8257261-8257283 CTGAGTCAGCAGGTCTGGAAGGG - Intergenic
1063784702 10:9367452-9367474 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1065099154 10:22316582-22316604 CTGGATCCGCCGGGGTGGAGGGG + Intronic
1065776660 10:29126599-29126621 CTGAATCAGTGGGTCTGGAGTGG - Intergenic
1065805730 10:29391996-29392018 CTGAAGCGGGAGGAGTTGAGGGG - Intergenic
1065872776 10:29970246-29970268 CTGATTCAGCAGGACTGGGCTGG - Intergenic
1066342042 10:34544613-34544635 CTGATTCAGCAGGACTGATGGGG - Intronic
1066362078 10:34740709-34740731 CTGAATCAGTAGGAAAAGAGGGG - Intronic
1066652697 10:37673625-37673647 CTGAATAAATAGGAGTGGAGTGG + Intergenic
1066942831 10:41891338-41891360 TGGAATCAACATGAGTGGAGTGG + Intergenic
1066946044 10:41911805-41911827 TGGAATCAACACGAGTGGAGTGG + Intergenic
1066946272 10:41913297-41913319 TGGAATCAACACGAGTGGAGTGG + Intergenic
1066946720 10:41916104-41916126 CTGAATCAACCTGAGTGGAATGG + Intergenic
1067131520 10:43569565-43569587 CTGAATCATGAGGAATGGAGAGG - Intronic
1067568340 10:47353844-47353866 CTGAGTCAGTAAGAGGGGAGTGG - Intronic
1068079862 10:52306631-52306653 CTGAATCAGGAGGATTGCATGGG - Intergenic
1068103297 10:52582480-52582502 CTAAATTAGTAGGAGTAGAGTGG - Intergenic
1068386388 10:56333589-56333611 CTGATTCAGAAGGTCTGGAGTGG + Intergenic
1068499039 10:57819829-57819851 CTGAAGAAGGAGGAGTGGTGGGG + Intergenic
1068928907 10:62568536-62568558 CTGATTCAGTAGGTCTGGAGTGG - Intronic
1069696739 10:70392019-70392041 CTGAAGCAACAGGAGTGGGTAGG + Intergenic
1069761341 10:70813672-70813694 CTGATTCAGGAGGTCTGGAGTGG + Intergenic
1070081461 10:73192237-73192259 GTGAAGCAGTAGGAGTGGAGAGG + Intronic
1070322627 10:75365863-75365885 GTTAATCAGCAGGAAGGGAGTGG - Intergenic
1070699905 10:78594134-78594156 GTGAAGCAGAAGGAGTGGAGGGG - Intergenic
1070830632 10:79415983-79416005 CTGACCCAGCAGGACTGGGGTGG + Intronic
1070930273 10:80256095-80256117 CTCACTGAGCAGGACTGGAGAGG + Intergenic
1070994101 10:80760599-80760621 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1071786985 10:88912188-88912210 CTGATTCAGCAGGTCTGGGGTGG - Intronic
1072094498 10:92163650-92163672 CTTAAACAGCAGGAGTGCTGGGG + Intronic
1072317453 10:94216481-94216503 CTGACTTAGCTGGAGTGAAGGGG + Intronic
1072449291 10:95526567-95526589 CTGAATCAGCAGGTCTGGGGTGG + Intronic
1073430185 10:103480789-103480811 CTGAACCAGCAGGGCTGGTGTGG + Intergenic
1073696783 10:105878254-105878276 CTGAATAAGCAAAAATGGAGAGG + Intergenic
1075314967 10:121445753-121445775 CTAAATCAGGAGTTGTGGAGCGG + Intergenic
1078320161 11:10327276-10327298 CTGAGTCTTCAGGAGTGGAGTGG - Intronic
1079484054 11:20915371-20915393 CTGTTTCAGTAGGATTGGAGTGG - Intronic
1079493861 11:21018941-21018963 CTAAATCATCTTGAGTGGAGTGG - Intronic
1079603872 11:22342391-22342413 CAGACTAAGCAGGAGTTGAGTGG + Intronic
1080637339 11:34135499-34135521 CTGATTCAGTAGGTCTGGAGTGG - Intronic
1080637640 11:34137930-34137952 TTGAAGCAGCTGCAGTGGAGTGG + Intronic
1080758910 11:35228833-35228855 CTGATTCAGCAGGTTTGGGGTGG + Intronic
1081061042 11:38477917-38477939 CTGAAACAGCTGGAGGTGAGTGG + Intergenic
1082051262 11:47772290-47772312 CTGAATCAGTTGGAGTGGGGTGG + Intergenic
1083254315 11:61486881-61486903 CTGAGGCAGCAGGGATGGAGAGG - Intronic
1083560759 11:63671355-63671377 CAGAAGCAGCAGGGGTGCAGAGG + Exonic
1084454601 11:69261188-69261210 CATAATCAGCAAAAGTGGAGGGG - Intergenic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1085442599 11:76578048-76578070 CTGATTCAGCAGGTCTGGGGCGG + Intergenic
1085528680 11:77179022-77179044 CTGAAACAGCAGTAGTGGCGCGG - Intronic
1086190107 11:84069105-84069127 CTGAATCAGCACCTCTGGAGGGG - Intronic
1088792870 11:113241651-113241673 CTGAATGTGCAGGAGTAGAAGGG + Intronic
1089042999 11:115471631-115471653 CTGACTCAGCAGGTCTGGAGTGG + Intronic
1089807791 11:121106886-121106908 CTGACTCAGTAGGTGTGGGGTGG - Intronic
1089996020 11:122908264-122908286 CTGATTCAGCAGGTGTAGGGTGG + Intronic
1090445395 11:126760647-126760669 CAGGATCTGCAGGAGTTGAGAGG + Intronic
1090522404 11:127493361-127493383 CAGAATCAGCATGAGAGGGGAGG - Intergenic
1091028825 11:132165245-132165267 CTGTATCAGCAGTCTTGGAGTGG + Intronic
1092178769 12:6430177-6430199 CTGAAGCAGAAGGAGTTTAGGGG + Intergenic
1092234382 12:6797086-6797108 CTGATTCAGCAGGTCTGGGGTGG + Intronic
1094182558 12:27607565-27607587 CTGATTCAGTAGGTGTGGGGTGG + Intronic
1095988356 12:48016066-48016088 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
1096317557 12:50581724-50581746 CTGAGTCAGCAGGAGTTGAGTGG - Intronic
1096657612 12:53101457-53101479 CTGATTCAGGAGGTGTGGGGTGG + Intronic
1096802981 12:54123780-54123802 CTGTTTCAGCAGGAGTTGTGGGG - Intergenic
1096936041 12:55277614-55277636 TTGAATCAGAAGGAAGGGAGAGG + Intergenic
1097301726 12:58026294-58026316 CTGATTCAGCAGGACTGGGATGG + Intergenic
1097918192 12:65042024-65042046 CTGCATCTGGGGGAGTGGAGAGG + Intergenic
1098288941 12:68936185-68936207 CTGATTCAGTAGGTTTGGAGTGG - Intronic
1099260955 12:80382309-80382331 CTGCATGAGCAGAAGTGGAGTGG - Intergenic
1099543384 12:83944282-83944304 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1099932628 12:89091535-89091557 CTGAAGCAGCTGGAATGCAGGGG - Intergenic
1101590713 12:106122779-106122801 CTGATTCAACAGGGTTGGAGTGG - Intronic
1102104910 12:110313184-110313206 CTGAATCATGGGGAGTAGAGAGG - Intronic
1102205000 12:111084192-111084214 CTGAATCAGCAGGAGTGGAGTGG + Intronic
1102545366 12:113650643-113650665 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1102755240 12:115334517-115334539 CTGAGGCAGCAGGTCTGGAGTGG + Intergenic
1102895861 12:116598144-116598166 CTGAATCAGTGGCACTGGAGAGG + Intergenic
1102922713 12:116804311-116804333 CTGAATCAGTAGGTCTGGGGTGG - Intronic
1103128182 12:118443011-118443033 CTGATTCAGCAGGTTTGGGGAGG + Intergenic
1103300967 12:119926476-119926498 CTGATTCAGCAGGTTTGGGGTGG - Intergenic
1104384613 12:128339498-128339520 CTAAATCAGTGGGAGAGGAGGGG - Intronic
1105254762 13:18736521-18736543 CTGAATCAGGAGGAGAAAAGAGG + Intergenic
1105463705 13:20617260-20617282 CTGAATAAGTAGGAGTGGGTTGG + Intronic
1105745507 13:23373968-23373990 CTGGAGCAGCGGCAGTGGAGGGG - Intronic
1105983045 13:25538332-25538354 CTGAGTCAAGAGCAGTGGAGTGG + Intronic
1106458559 13:29948627-29948649 TGGATTAAGCAGGAGTGGAGAGG - Intergenic
1106506779 13:30377253-30377275 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
1107163803 13:37262702-37262724 CAGAATCAGGAGGAGGTGAGAGG + Intergenic
1108225110 13:48281311-48281333 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1108263165 13:48678525-48678547 CTGAAGCCAGAGGAGTGGAGAGG - Intronic
1108733933 13:53262737-53262759 CTGATTCAGTAGGCCTGGAGTGG - Intergenic
1110797308 13:79654692-79654714 CTGATTCAGCAGGTCTGGAATGG + Intergenic
1111986488 13:95071290-95071312 CAGAAGCTGCAGCAGTGGAGGGG + Intronic
1113460095 13:110476189-110476211 GTCAATGAGCAGGAGTGGGGTGG + Intronic
1113613806 13:111666453-111666475 ATGGTTCAGCAGGAGAGGAGAGG + Intronic
1117334161 14:54742473-54742495 CTGAAACTGCAGGCGAGGAGAGG - Intronic
1117521300 14:56553861-56553883 CTGAATCAGTAGGTCTGGACGGG - Intronic
1118055972 14:62080253-62080275 CTGATTCAGTAGGTCTGGAGTGG - Intronic
1118654682 14:67933874-67933896 CTGACTCAGCAGGAGCATAGAGG - Intronic
1121097027 14:91224645-91224667 CAGAAATAGAAGGAGTGGAGGGG - Intronic
1121226552 14:92325373-92325395 CTGACTCAGCAGGTCTGGGGTGG - Intronic
1121651578 14:95562715-95562737 CCAAAGCAGTAGGAGTGGAGGGG + Intergenic
1122902813 14:104788797-104788819 CTAACTCAGCAGGAGTGGTGAGG + Intronic
1123137097 14:106038100-106038122 CTCACTCAGCACTAGTGGAGTGG - Intergenic
1123755939 15:23397785-23397807 CTGACTCAGTAGGACTGAAGTGG - Intergenic
1124505444 15:30268698-30268720 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1124738108 15:32269933-32269955 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
1124783748 15:32659759-32659781 CTGGAGCAGCAGGAATGGATGGG + Intronic
1126874994 15:53032023-53032045 CTGATTCAGTAGGTCTGGAGTGG - Intergenic
1127436364 15:58962330-58962352 CTGTACCAGCAGGACAGGAGAGG + Intronic
1128229768 15:66026244-66026266 CTGATTCAGGAGGTGTGGCGAGG + Intronic
1128491466 15:68150267-68150289 CTGAAACTGTAGGAGAGGAGGGG + Intronic
1128655144 15:69455265-69455287 CTGGAGCAGCAGCAGTGGAGGGG - Exonic
1128745482 15:70111370-70111392 CTGGATCAGCTGGATTGGGGTGG + Intergenic
1128936362 15:71749616-71749638 CTGAGGCAGCAGGTGTGGGGAGG + Intronic
1128961369 15:72008657-72008679 CTGAATTAACAGGAGTTGATGGG - Intronic
1129692336 15:77720961-77720983 CTGGGTCAGCAGGCCTGGAGAGG + Intronic
1129749206 15:78048810-78048832 CTGAGACAGCAGGAGAGGAGAGG - Intronic
1129785368 15:78306616-78306638 ATGAATCAGCAGGTCTGGAGAGG + Intergenic
1129956261 15:79639533-79639555 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
1130038278 15:80381132-80381154 CTGATTCAGCAGGCCTGGAGAGG - Intronic
1130742002 15:86610961-86610983 CTGATTCAGCAGGTCTGAAGTGG - Intronic
1131021670 15:89104360-89104382 CTGAATTGGCAGGGGAGGAGAGG + Intronic
1131446483 15:92502212-92502234 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1131457118 15:92590235-92590257 CTGGATGAGCAGGAGTCCAGGGG - Intergenic
1131481654 15:92787486-92787508 CTGATTCAGTAGGTGTGGGGTGG - Intronic
1131481660 15:92787500-92787522 CTGAATCAGAAGCTCTGGAGTGG + Intronic
1131653180 15:94424468-94424490 CTGATTCAGCAGATTTGGAGGGG - Intronic
1132187889 15:99819067-99819089 CTGGATCAGCAACAGGGGAGAGG + Intergenic
1132931816 16:2462544-2462566 CTGTATCAGGAGGAGTGTGGAGG + Intronic
1133156003 16:3876713-3876735 CTGAAGCAGCAGCCCTGGAGAGG - Intronic
1134346924 16:13399775-13399797 CTGATTCAGTAGGTCTGGAGTGG + Intergenic
1134460391 16:14424933-14424955 CTGACTCAGTAGGACTGAAGTGG + Intergenic
1135048453 16:19172975-19172997 CGGAATAAGTAGGGGTGGAGAGG - Intronic
1135126003 16:19809808-19809830 TGGAGTCAGTAGGAGTGGAGTGG + Intronic
1135143805 16:19944214-19944236 CTGATTCAGTAGGCGTGAAGTGG + Intergenic
1135632274 16:24045727-24045749 CTGATTCAGCAGGCCTGGAGGGG - Intronic
1135663657 16:24317753-24317775 CTGATTCAGCAGGTCTGGGGTGG - Intronic
1135984941 16:27177208-27177230 CTGATTCAGCAGGTCTGGAGTGG - Intergenic
1136362730 16:29791158-29791180 CTGAATAAGCAAGAGAAGAGTGG + Intronic
1138202744 16:55102118-55102140 CTGGATCAGCAGGAGGGAAGGGG - Intergenic
1138552689 16:57756092-57756114 CTGAAGCAGGGGGAGGGGAGAGG + Intronic
1139392628 16:66614538-66614560 CTGGGTGTGCAGGAGTGGAGAGG + Intergenic
1139447462 16:67006669-67006691 CAGAAGCAGCAGGAGTAGGGTGG + Intronic
1139516278 16:67454163-67454185 CTGAAGCTGTGGGAGTGGAGTGG + Intronic
1139999909 16:71014445-71014467 CTGAACCAGATGGACTGGAGGGG - Intronic
1140378568 16:74465497-74465519 CTGATTCAGCAGATCTGGAGGGG + Intronic
1140588411 16:76322177-76322199 CTGAATCAGCAGGAAGGCAGGGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141173691 16:81705992-81706014 CTGAGTCAGGAGGTCTGGAGTGG - Intronic
1141179958 16:81745775-81745797 CTGATTCAGCAGATCTGGAGGGG + Intronic
1142224954 16:88872758-88872780 CTGAGGCTGCAGGACTGGAGGGG - Intergenic
1142420331 16:89966068-89966090 CTGGCCCAGCAGGGGTGGAGGGG - Exonic
1142592241 17:1011389-1011411 CTGAACCAGCAGGAGCAGGGAGG + Intronic
1143872108 17:9964456-9964478 CTAAATCAGCAGGAATAGGGAGG - Intronic
1144213272 17:13032973-13032995 CCGATTCAGTAGGAGTGGAGTGG + Intergenic
1144531654 17:16044861-16044883 CTGGAGCAGCAGCAGTGGAGTGG - Intronic
1145056576 17:19707307-19707329 CTGAAACAGCAGGCGTGTAGGGG - Intronic
1145166029 17:20614114-20614136 CTGGCCCAGCAGGGGTGGAGGGG - Intergenic
1145344234 17:21978776-21978798 TTAAATCAACAGGAATGGAGTGG + Intergenic
1145344682 17:21981572-21981594 CTGAATCAACTGGAATGGAATGG + Intergenic
1145345159 17:21985354-21985376 TTGAATCAACACGAGTGGAATGG + Intergenic
1145345506 17:21987601-21987623 TTGAATCAACATGAATGGAGTGG + Intergenic
1145345810 17:21989801-21989823 TTGAATCAACATGAGTGGAATGG + Intergenic
1145346114 17:21991727-21991749 CTGAATCAACCCGAGTGGAATGG + Intergenic
1146498291 17:33342787-33342809 ATGAATGAGGAGGTGTGGAGGGG - Intronic
1148238398 17:45984014-45984036 CAGAAGCAGCAGGAGTCGGGAGG - Intronic
1148396804 17:47314699-47314721 CTGATTCAGCAGCTGTGGGGTGG - Intronic
1148804640 17:50257986-50258008 CTGCCTCAGCTGAAGTGGAGGGG + Intergenic
1149291660 17:55223815-55223837 CTGACTCTGCTGGAGTGGACAGG - Intergenic
1150139304 17:62715076-62715098 CTGATTCAGCTGGACTGGAGTGG + Intronic
1150193889 17:63273838-63273860 CTGATTCAGTAGGTGTGGAATGG - Intronic
1150329644 17:64284582-64284604 CAGGATCAGCAGGAATGGTGTGG - Intergenic
1150441591 17:65195932-65195954 CTGATTCAGTAGGAGTGGGTGGG - Intronic
1151984230 17:77531699-77531721 CTGTATCTCCAGGACTGGAGAGG + Intergenic
1151984307 17:77532249-77532271 CTGTATCTCCAGGACTGGAGAGG - Intergenic
1151990791 17:77572687-77572709 CTGATTCAGCAAGTCTGGAGTGG - Intergenic
1152564797 17:81095509-81095531 CTGGAACAGCAGGTGAGGAGAGG + Intronic
1203174640 17_KI270729v1_random:110-132 TTGAATCAGCACGAGTGGAATGG - Intergenic
1203175286 17_KI270729v1_random:4589-4611 CTGAATCAACCCGAGTGGAATGG - Intergenic
1203175624 17_KI270729v1_random:10895-10917 CTGAATCAACAGAAGTGTAATGG - Intergenic
1203175693 17_KI270729v1_random:11350-11372 CTGAATCAACTGGACTGGAATGG - Intergenic
1153752296 18:8245168-8245190 CTGGAAGAGGAGGAGTGGAGGGG - Intronic
1154015039 18:10608697-10608719 CTGACTCAGCACCTGTGGAGAGG + Intergenic
1154015544 18:10613401-10613423 CTGACTCAGCACCTGTGGAGAGG + Intergenic
1154189965 18:12222235-12222257 CTGACTCAGCACCTGTGGAGAGG - Intergenic
1154190474 18:12226947-12226969 CTGACTCAGCACCTGTGGAGAGG - Intergenic
1154436265 18:14344082-14344104 CTGAATCAGGAGGAGAAAAGAGG - Intergenic
1154490856 18:14921117-14921139 GGGAATCAGCAGTGGTGGAGAGG + Intergenic
1155926027 18:31656028-31656050 CAGACTCAGCAGGTCTGGAGCGG - Intronic
1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG + Intergenic
1157524012 18:48364954-48364976 CTGATTCAGCAGGGCTAGAGTGG + Intronic
1158367398 18:56753240-56753262 GTGAAGCAGTGGGAGTGGAGAGG + Intronic
1158894601 18:61901173-61901195 CTGGAGCAGCAGGAGGGGAGGGG - Intergenic
1158982750 18:62780644-62780666 CTGATTCAGTAGGTCTGGAGTGG + Intronic
1159302300 18:66590148-66590170 ATGAATCAGTAGCTGTGGAGTGG - Intronic
1159384921 18:67710730-67710752 CTCTATCAGCAGGAGTCCAGGGG - Intergenic
1160591229 18:79945683-79945705 CTGCAGGAGCAGGAGTGCAGGGG + Intronic
1161600300 19:5178174-5178196 GAGAATCAGCAGGAAAGGAGAGG - Intronic
1163627686 19:18399750-18399772 CTGCATAGGCTGGAGTGGAGTGG - Intergenic
1166411802 19:42560527-42560549 CTGAATCAGCAGGGATGCATTGG + Intronic
1167165828 19:47799213-47799235 CAGAAGAAGCAGGAGAGGAGAGG + Intergenic
1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG + Exonic
1167867157 19:52337521-52337543 GAGAAACAGCAGGAGAGGAGAGG + Intronic
925538759 2:4943746-4943768 TTGAATAAGCAGGAGTGGATGGG + Intergenic
925619385 2:5776203-5776225 CTGATTCAGCAGGTCTGCAGTGG + Intergenic
926167050 2:10527760-10527782 GTGAAGCAGCAGGAGAGAAGGGG - Intergenic
927030676 2:19117774-19117796 CTAAATCAGTACCAGTGGAGTGG - Intergenic
927198430 2:20563864-20563886 CTGATTCAGCAGGTCTGGGGTGG - Intronic
927285978 2:21357082-21357104 CTGAATCAGCAGGTCTAGGGTGG - Intergenic
928125962 2:28616450-28616472 CTGATTCAGCAGGTTTGGGGTGG - Intronic
928411292 2:31056140-31056162 CTGACTCAGCAGGACTGAGGGGG + Intronic
928726386 2:34178774-34178796 CTGAATCAGTAACTGTGGAGTGG - Intergenic
929131758 2:38582348-38582370 CTCTATCACCAGGAGTGCAGTGG + Intronic
929198377 2:39209560-39209582 CTGATTCAGCAGGTCTGTAGTGG + Intronic
929803867 2:45127765-45127787 CTCCATCAGCAGGAGTAAAGAGG + Intergenic
929888073 2:45896005-45896027 CTGGATGCGCAGGAGTGGGGTGG + Intronic
930748229 2:54906530-54906552 GGGAATGAGCAGGAGAGGAGTGG + Intronic
931830798 2:66049316-66049338 CTGAGTCAGCAGGTCTGGTGTGG + Intergenic
931891353 2:66675954-66675976 CTGATTCAGCAGGCCTGGTGTGG - Intergenic
931905851 2:66843133-66843155 CTGTATCAGCAGTTCTGGAGAGG - Intergenic
932613614 2:73218022-73218044 CTGATTCAGCAGGTCTGGGGTGG + Intronic
932831992 2:74999040-74999062 CTGAATCAGAAGTGGTGGGGTGG + Intergenic
933665315 2:84960097-84960119 TGGAATCACCAGGAGGGGAGTGG - Intergenic
933788825 2:85867305-85867327 CTGAGTCAGCAAGACTGGGGCGG - Intronic
934052191 2:88220255-88220277 CTGACTCAGGAGGCCTGGAGCGG + Intergenic
934110619 2:88738923-88738945 CTGAAGCACCAGGCGAGGAGAGG + Intronic
934195464 2:89834562-89834584 TTGAATCAACACGAGTGGAATGG - Intergenic
934779650 2:96961454-96961476 CAGAATCAGAGGGAGGGGAGAGG + Intronic
934972010 2:98771355-98771377 CTGATTCAGTAGGTCTGGAGAGG - Intergenic
935006152 2:99079484-99079506 CTGATTCAGTAGGTCTGGAGTGG - Intronic
935087189 2:99859394-99859416 CTGACTCAGTAGGTCTGGAGTGG - Intronic
935390085 2:102541834-102541856 CTGAATCAGCAGATGTGGGGTGG + Intergenic
935584410 2:104787838-104787860 CTGATTCAGCAGGCCTGGGGTGG - Intergenic
936490185 2:112963411-112963433 CTGATTCAGTAGGTCTGGAGTGG + Intergenic
937083168 2:119154788-119154810 CACAATCAGCAGGAGTGGGGTGG + Intergenic
937209806 2:120261027-120261049 CTGATTCAGTAGGTCTGGAGTGG - Intronic
937649879 2:124307902-124307924 CTGATCCAGCAGGCCTGGAGTGG - Intronic
938109116 2:128552465-128552487 CTGATTCAGCAGGCCTGGGGTGG - Intergenic
938600184 2:132829720-132829742 CTGAATCAGGAGGTGTAGGGTGG + Intronic
938678780 2:133667354-133667376 CTGAATCAGCAGAGATGGAGTGG - Intergenic
938698330 2:133854546-133854568 CTGATTCAGTAGGTCTGGAGTGG - Intergenic
938899999 2:135791687-135791709 GAGAATCAGAAGGAGTAGAGGGG + Intronic
939385106 2:141485940-141485962 CTGAATCATGAGGAGTTGGGAGG + Intronic
942427375 2:175874217-175874239 CTGAATCAGCTGGTTTGGGGTGG - Intergenic
942465227 2:176200988-176201010 CTGGAGCAGCAGCAGTGGAGGGG + Intergenic
942908250 2:181208797-181208819 GTGAACCAGCAGGACTGGAAGGG - Intergenic
944142178 2:196468534-196468556 CTGAGTCAGTAGGATTGGAGTGG + Intronic
944657555 2:201891258-201891280 CTGACGCACCAGGAGTGCAGTGG - Intronic
945236483 2:207636377-207636399 CTGAAACAGCAGGCAAGGAGAGG - Intergenic
945550697 2:211218463-211218485 CTGATTCAGCAGGTGTGAGGTGG - Intergenic
945680240 2:212904961-212904983 CTGAGTAGGCAGGAGTGGATAGG + Intergenic
945719095 2:213396579-213396601 CTCCATCAGCAGCAGTGGACAGG + Intronic
946402593 2:219476457-219476479 ATGAATCCGCGGGAGAGGAGTGG - Intronic
946404528 2:219485192-219485214 TGGAATCAGCAGGGCTGGAGGGG + Intronic
946990293 2:225321663-225321685 CTGATTCAGCAAGTCTGGAGAGG + Intergenic
947025631 2:225734860-225734882 CTCAACCAGCAGTGGTGGAGTGG + Intergenic
947205938 2:227661220-227661242 CGCAGTCAGCAGGAGAGGAGGGG - Intergenic
948129685 2:235591357-235591379 CTGAACGAGGGGGAGTGGAGTGG + Intronic
948267049 2:236642711-236642733 CTTAATCAGCAGGCCTGGGGTGG + Intergenic
1168729927 20:67280-67302 CTGACTCCACTGGAGTGGAGTGG - Intergenic
1169093937 20:2879315-2879337 CTGAATCAGTAGGTTTGGGGTGG + Intronic
1169304804 20:4480183-4480205 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1169672816 20:8122747-8122769 CTGATACAGTAGGATTGGAGTGG + Intergenic
1170284573 20:14692163-14692185 CTGAATCAGTAGGTGTGGGGTGG - Intronic
1171194879 20:23189273-23189295 CTGAATCAGAAGGACAGGAAAGG + Intergenic
1171793774 20:29550808-29550830 CTGTTTCAGCAGGAGTTGTGGGG + Intergenic
1171879591 20:30608507-30608529 CTGAATCAGCAGGAGAAAAGAGG + Intergenic
1172517864 20:35547977-35547999 CTGATTCAGCAGGTCTGGAGTGG + Intronic
1172666633 20:36605003-36605025 CTGAGTCAGTAGGCGTGGAATGG + Intronic
1172850362 20:37958035-37958057 CTGATTCAGTAGAACTGGAGTGG + Intergenic
1173161833 20:40658606-40658628 CCCACTCTGCAGGAGTGGAGGGG - Intergenic
1173392877 20:42650478-42650500 CTCAATCAGCTGCAGTAGAGGGG + Intronic
1173454894 20:43194081-43194103 CTGATTCAGCAGGCCTGGGGTGG - Intergenic
1173549598 20:43923463-43923485 CTGACTCAGCAGGCCTGGGGAGG + Intronic
1174035912 20:47668143-47668165 CTGAGACAAAAGGAGTGGAGAGG - Intronic
1174557896 20:51408877-51408899 CTAATTCAGCAGGACTGGGGTGG + Intronic
1175597855 20:60249690-60249712 CTGAATCAGCAAGTCTGGGGAGG + Intergenic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1176840775 21:13841557-13841579 CTGAATCAGGAGGAGAAAAGAGG + Intergenic
1177892968 21:26828304-26828326 CTGCACCAGCAGGATTTGAGGGG + Intergenic
1178058419 21:28825267-28825289 CTGATTCAGTAGGTCTGGAGAGG + Intergenic
1178467976 21:32866113-32866135 CTCAATCAGCTGGAGTGTTGAGG + Intergenic
1178696392 21:34796473-34796495 CTGATTCAGCAGAAGTGTGGGGG + Intronic
1180076417 21:45465631-45465653 CTGGCTCTGCAGGACTGGAGGGG + Intronic
1181533873 22:23531938-23531960 CAGAAACAGCAGGACAGGAGAGG + Intergenic
1181869045 22:25883444-25883466 CTGAATCAGTAGGCTTGGCGTGG + Intronic
1182322544 22:29487678-29487700 CTGATTCAGCAGGTCTGGGGAGG - Intronic
1183006309 22:34905527-34905549 CTGAAGCAGGAGGAGGGTAGGGG + Intergenic
1183024376 22:35053176-35053198 CTGAATCAGGAGGACTCCAGGGG + Intergenic
1183271453 22:36865081-36865103 CTGCAGCAGCAGGACGGGAGTGG - Intronic
1183485780 22:38087097-38087119 CTGAGTCATCAGGGGTGGGGCGG - Intronic
1183659104 22:39208001-39208023 CTGATTCTTCAGGAGAGGAGAGG + Intergenic
1184721613 22:46317797-46317819 TTGCAGCAGCAGGAGTGCAGGGG - Intronic
1185007527 22:48290845-48290867 CTGATTCAGCAGGTGTTGGGTGG - Intergenic
1185294788 22:50047711-50047733 CTCTATCAGCAGGGGAGGAGCGG - Intronic
1185410408 22:50678682-50678704 CTGACTCAGGAGGTGAGGAGTGG + Intergenic
1185415758 22:50709304-50709326 CTGAATGAGCAGGATTAGCGGGG - Intergenic
1203301518 22_KI270736v1_random:80449-80471 TTGAATGAGGTGGAGTGGAGTGG + Intergenic
1203307513 22_KI270736v1_random:119740-119762 TGGAATGAACAGGAGTGGAGTGG + Intergenic
949782281 3:7703257-7703279 CTGATTCAGCAGGTCTGGAGTGG - Intronic
949787099 3:7753756-7753778 CTGATTCAGTAGCAGTGGAATGG + Intergenic
949934384 3:9105586-9105608 GTGACTCAGCAGGTCTGGAGTGG - Intronic
950034889 3:9878298-9878320 CTGATTCAGGAGGTCTGGAGTGG - Intronic
950236683 3:11327850-11327872 CTGATTCAGCAGGTCTGGGGAGG + Intronic
950744163 3:15073767-15073789 CTGACTGACCAGCAGTGGAGAGG - Exonic
950831844 3:15882488-15882510 CAGAATCAGTAGGTCTGGAGTGG - Intergenic
950957497 3:17070195-17070217 CTGAATCAGCAGGACTAGGGTGG - Intronic
950964299 3:17135680-17135702 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
951063408 3:18236645-18236667 CTGAATCAGGAAGTCTGGAGTGG + Intronic
951297521 3:20957165-20957187 TTGACTCAGCTGGAGTGCAGTGG - Intergenic
951575384 3:24108038-24108060 CTGATTCAGCAGGCCTGGGGTGG - Intergenic
951597058 3:24329879-24329901 CTGATTCAGTAGGTCTGGAGTGG - Intronic
951612945 3:24511818-24511840 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
951898689 3:27635264-27635286 CTGAATAAATAGGAGTGGGGTGG - Intergenic
952410705 3:33047423-33047445 CTAATTCAGCAGGTCTGGAGTGG + Intronic
952568972 3:34690995-34691017 CTGAATCAGTAGCTCTGGAGTGG + Intergenic
952717600 3:36495887-36495909 CTGATTCAGCAGGTGTGGAATGG - Intronic
952747056 3:36791368-36791390 CAGAATCAGCAGAAGAGGAGTGG - Intergenic
953106941 3:39890993-39891015 CTAAAACAGAAGAAGTGGAGTGG - Intronic
953182087 3:40605317-40605339 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
953344029 3:42160200-42160222 CTGGCTCAGCTGAAGTGGAGGGG - Intronic
953344465 3:42163607-42163629 CTGATTCAGTAGGTCTGGAGTGG - Intronic
953441861 3:42925128-42925150 CTGGAGCTGCAGAAGTGGAGAGG + Intronic
954166493 3:48763160-48763182 CTGATTCAGCAGGTCTGGTGGGG + Intronic
955522777 3:59791312-59791334 CTGAAGCAGCGGGGGTGGGGTGG + Intronic
955595747 3:60588566-60588588 CTGAATCAGTTGGTCTGGAGTGG - Intronic
955783167 3:62507673-62507695 CTGATTCAGCAGGTCTGGGGTGG - Intronic
956341019 3:68224299-68224321 CTAAATCAGCAGGTGTGTGGAGG - Intronic
956667474 3:71655852-71655874 CTGAAGCAGTGGGAGTGGGGAGG + Intergenic
957041272 3:75337241-75337263 CTGAACCAGGAGGAGGGGAAGGG + Intergenic
957337992 3:78857627-78857649 CTGAGTCAGCAGGTCTGGGGTGG - Intronic
961046080 3:123708896-123708918 CTGAACCAGGAGGAGGGGAAGGG + Intronic
961173453 3:124815495-124815517 CTGACTCAGCAGGAGGCAAGCGG + Intronic
961617214 3:128192385-128192407 ATGAATCTGCAGGAGAAGAGCGG - Intronic
961994086 3:131222778-131222800 CTGATTCAGCAGGTCTGGTGTGG - Intronic
962286000 3:134085919-134085941 TTGAATCAGAAGCAGTGGGGTGG + Intronic
962425023 3:135262077-135262099 CTGATTCAGCAGGTCTAGAGTGG + Intergenic
964032941 3:152160402-152160424 CAGCCTAAGCAGGAGTGGAGAGG - Intergenic
964301222 3:155287577-155287599 CTGATTCAGCAGGTGTGCACTGG - Intergenic
964807696 3:160629689-160629711 CTGATTCAGTAGGTCTGGAGTGG + Intergenic
964848710 3:161070765-161070787 CTACAGCAGCAGGAGGGGAGAGG - Exonic
967232063 3:187348742-187348764 CTGGGGCAGCAGGAGTGGGGTGG + Intergenic
967351963 3:188523977-188523999 CAGAATCAACAGGAGAGTAGAGG - Intronic
968522699 4:1041215-1041237 CGGGAGCAGCAGGAGGGGAGCGG - Intergenic
969031296 4:4216956-4216978 CTGATTCAGCAGGTGTGGACGGG + Intronic
969954730 4:10877235-10877257 CTGATTCAGTAGGTCTGGAGTGG - Intergenic
972816703 4:42654057-42654079 CTGATTCAGGAGGTCTGGAGTGG - Intronic
973216007 4:47670133-47670155 CTGAATCAACAAGAGTGGGCTGG + Intronic
973351061 4:49102484-49102506 TGGAATCAACCGGAGTGGAGTGG - Intergenic
973351986 4:49108301-49108323 TGGAATCAACCGGAGTGGAGTGG - Intergenic
973352211 4:49109665-49109687 TGGAATCAACCGGAGTGGAGTGG - Intergenic
973352350 4:49110481-49110503 TGGAATCAACCGGAGTGGAGTGG - Intergenic
973352676 4:49112480-49112502 TGGAATCAACCGGAGTGGAGTGG - Intergenic
973352693 4:49112595-49112617 AGGAATCAGCCCGAGTGGAGTGG - Intergenic
973353989 4:49120539-49120561 TGGAATCAACCGGAGTGGAGTGG - Intergenic
973359935 4:49155709-49155731 CAGAATCAACATGAGTGGAATGG - Intergenic
973403689 4:49654233-49654255 TGGAATCAACCGGAGTGGAGTGG + Intergenic
973552976 4:52053464-52053486 CAGATGAAGCAGGAGTGGAGGGG - Intronic
973875438 4:55213557-55213579 CTGAATCAGAAGCTGTGGTGAGG + Intergenic
974291370 4:59935793-59935815 CTGAATCAACAGGCCTGGATCGG + Intergenic
977249604 4:94675190-94675212 CTGATTCAGCTGGAGTGGAGTGG + Intergenic
978639126 4:110847985-110848007 CTTTATTAGCATGAGTGGAGTGG - Intergenic
978745986 4:112194890-112194912 CTGTCTCAGCAGGAGTGGTTGGG + Exonic
978871752 4:113586727-113586749 CTCAATCAGTAGTACTGGAGTGG - Intronic
980252466 4:130335557-130335579 CAACATGAGCAGGAGTGGAGAGG + Intergenic
984258825 4:177419738-177419760 CTGATTCAGTAGGTGTGGGGAGG + Intergenic
985923615 5:2998858-2998880 CAGAGACAGCAGGAGGGGAGAGG + Intergenic
985998362 5:3610524-3610546 CTGTTTCAGCAGGAGTGGAGTGG + Intergenic
986052814 5:4105582-4105604 CAGAAAGAGCTGGAGTGGAGGGG + Intergenic
986087751 5:4468612-4468634 CTGACTCAGCAGGAGGAGAGAGG - Intergenic
986494515 5:8329097-8329119 TTCATACAGCAGGAGTGGAGAGG + Intergenic
986771355 5:10976981-10977003 CTGATTCAGTAGGTCTGGAGTGG - Intronic
988694255 5:33604252-33604274 CTGAAGGAGCAGGAATGAAGTGG + Intronic
989300293 5:39883756-39883778 CTGAGTTAGCTGGAGTAGAGAGG - Intergenic
989788048 5:45355391-45355413 CTGATTCAGTAGGTCTGGAGTGG - Intronic
989909389 5:49602792-49602814 TGGAATCAACAGGAGTGGAATGG + Intergenic
990613738 5:57485940-57485962 CAGAATCAGCAAGAGTTTAGAGG + Intergenic
990954063 5:61326622-61326644 CTGATTCAGCAGGGCTGGGGTGG - Intergenic
991632475 5:68670108-68670130 TTGATTCAGCAGGTCTGGAGTGG - Intergenic
991637670 5:68722589-68722611 CAGAAGCCGCAGGAATGGAGCGG - Intergenic
992668112 5:79031480-79031502 CTGAAGCAGCAGGTATGGGGTGG + Intronic
992881315 5:81113239-81113261 CTGATTCAGCAGGCCTGGTGTGG + Intronic
993972772 5:94440801-94440823 ATGAATCAGCAGGAGAGCAAAGG + Intronic
994395996 5:99226223-99226245 CCTAATAAGCAGAAGTGGAGAGG - Intergenic
994396216 5:99227647-99227669 CCTAATAAGCAGAAGTGGAGAGG - Intergenic
995573181 5:113503026-113503048 CTAAATCAGCAGTAGTGGCCAGG - Intergenic
996333774 5:122360886-122360908 CTGAATAATCAGGAGATGAGGGG + Intronic
996720762 5:126628094-126628116 CTGAAGCAGCAGCAGTGGAGGGG + Intergenic
996856120 5:128009459-128009481 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
998565795 5:143214805-143214827 CTGGGTCAGCAGGAGTGGGAGGG + Intronic
998628874 5:143876501-143876523 CTGAATGAGCAGAAGTGAACTGG + Intergenic
999216498 5:149940044-149940066 GTGAAGCAGTAGGAGTGGAGGGG + Intronic
999462034 5:151765976-151765998 CTGAAGCAGCAGCAATGGAGGGG + Intronic
999839850 5:155413245-155413267 CAGAATGAACAGGAGAGGAGTGG + Intergenic
1000930755 5:167248445-167248467 CTGATTCAGCATGTCTGGAGAGG + Intergenic
1001488045 5:172133970-172133992 CTGAATCAGAAGCTCTGGAGTGG - Intronic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1001932662 5:175684251-175684273 CTGAAGCTCCAGGTGTGGAGTGG + Exonic
1002095018 5:176825451-176825473 CAGAAGCAGCAGGAGTGAACTGG + Intronic
1003122065 6:3326557-3326579 CAAAAACAGAAGGAGTGGAGAGG - Intronic
1003525583 6:6894042-6894064 CTGATTCAGCAGGTGTGGGTCGG + Intergenic
1003557540 6:7154291-7154313 CTGATTCAGCAGGGCTGGAGTGG - Intronic
1003877166 6:10448658-10448680 CTGAATCAGTAGGTCTAGAGTGG - Intergenic
1003926940 6:10884969-10884991 CTGAATCAACAGGAGTTTCGGGG - Intronic
1004136150 6:12968964-12968986 CTGACTCAGCAGGTCTGAAGTGG + Intronic
1004304696 6:14488998-14489020 CTGATGCAGTAGGAGTGGGGAGG - Intergenic
1004399018 6:15271294-15271316 CTCATTCAGCAGGACTGAAGTGG + Intronic
1004440117 6:15641969-15641991 CTGCATCAGCAACAGTGTAGGGG - Intronic
1004653477 6:17634840-17634862 CTGTATCAGCAGGGGAGGCGGGG + Intronic
1004690644 6:17989346-17989368 TTGCAGCAGCAGGAATGGAGAGG - Intergenic
1005342682 6:24858099-24858121 CTGCAAAAGCAGGAGGGGAGAGG - Intronic
1006187866 6:32190809-32190831 CAGACTCAGCAGCAGTGGGGAGG + Exonic
1006188377 6:32192780-32192802 CTCCAGCTGCAGGAGTGGAGGGG + Exonic
1006867268 6:37219008-37219030 ATGAAACAGCAGCAGTGGTGTGG - Exonic
1007112528 6:39321153-39321175 CTGAGTCGGCAGGTGCGGAGTGG + Intronic
1007521958 6:42456911-42456933 CTGCATCAGAAGGAGTGGCATGG + Intergenic
1010308949 6:74359996-74360018 CTGATTCAGTAGGTGTGGGGTGG + Intergenic
1010578662 6:77566220-77566242 TTGATCCAGAAGGAGTGGAGTGG + Intergenic
1011271838 6:85587945-85587967 CTGCTTCAGCAGGGGAGGAGCGG + Intronic
1011952892 6:92989692-92989714 CTGATTCAGCAGGTCTGGATGGG - Intergenic
1013150343 6:107439774-107439796 CTGAATAAGCAGGACTGGGGAGG + Intronic
1014558008 6:122856513-122856535 CTGAATCAGAAACACTGGAGGGG - Intergenic
1016013535 6:139162288-139162310 TTGAAGCAGTAGGAGTGGGGAGG + Intronic
1017091613 6:150764001-150764023 CTGAGTCAGGTGGAGAGGAGAGG - Intronic
1018953877 6:168395251-168395273 CTGGAGCAGCAGGCGGGGAGGGG - Intergenic
1019074794 6:169378680-169378702 CTACACCAGCAGGAGAGGAGAGG - Intergenic
1019649933 7:2151419-2151441 CTGAAACAGCAGGAGGCCAGTGG + Intronic
1020362804 7:7347820-7347842 CTGAAACATAAGGTGTGGAGGGG + Intergenic
1020506500 7:8995703-8995725 TTGATTCAGCAGGTTTGGAGAGG - Intergenic
1021112529 7:16711915-16711937 CTGAATCAGCATGAGCTGGGAGG - Intergenic
1021421515 7:20450138-20450160 CTGATTCAGCAGGTCTGGAGAGG - Intergenic
1022064598 7:26838291-26838313 TTGAATAGGAAGGAGTGGAGGGG - Intronic
1022403680 7:30065927-30065949 CTGATTCAGCAGGTCTGGGGTGG - Intronic
1022662702 7:32381493-32381515 GTGAGCCAGCAGGAGAGGAGGGG - Intergenic
1022708457 7:32829438-32829460 CTGTCACAGCAGGAGTTGAGTGG + Intergenic
1022914717 7:34936039-34936061 CTGTCACAGCAGGAGTTGAGTGG - Intronic
1023300873 7:38769739-38769761 CAGAATCAATAGGATTGGAGAGG - Intronic
1023332597 7:39134341-39134363 CTGATTCAGTAGGTCTGGAGTGG + Intronic
1023520335 7:41044126-41044148 CTGATTCTGTAGGTGTGGAGAGG - Intergenic
1024016905 7:45325514-45325536 CTGACACAGCAGGACTGGAAGGG + Intergenic
1025950104 7:66138474-66138496 GTGAAGCAGTAGGAGTAGAGGGG - Intronic
1025956366 7:66186198-66186220 CTGATTCAGCAGGGCTGGGGTGG - Intergenic
1028235388 7:88355002-88355024 CTGAATTAGCAGGATGGGATGGG + Intergenic
1028941705 7:96528728-96528750 CTGAATCAGTAGGTCTGGAATGG - Intronic
1030189440 7:106795748-106795770 CTGAGTCAGCAGGAATGGAGAGG + Intergenic
1030561669 7:111094697-111094719 CTTTATCAGAAGGAGAGGAGAGG - Intronic
1031376151 7:121028178-121028200 CTGATTCAGTAAGAATGGAGAGG + Intronic
1032081137 7:128859023-128859045 CCGAACCAGCAGGAGTGGCCTGG + Exonic
1032232227 7:130084854-130084876 CTGAAGCAGCAGGATTGTAGGGG + Intronic
1032417053 7:131743810-131743832 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1033649311 7:143328873-143328895 CTGGATGAGCAGGGGAGGAGAGG - Intronic
1036474968 8:9084832-9084854 CTGAAGAAGCTGAAGTGGAGAGG + Intronic
1036800744 8:11789213-11789235 CTGTAGCTGTAGGAGTGGAGAGG + Intergenic
1037139740 8:15505643-15505665 CTGATTCAGCAGGTCTGAAGTGG + Intronic
1037812365 8:22094691-22094713 CTAAATCATCAGGAGTGGAGTGG - Intronic
1037870472 8:22490290-22490312 CTGACTCATCAGGCGTGGGGTGG + Intronic
1038255417 8:25946700-25946722 TTGAATCAGCAGGATTTGACTGG - Intronic
1038780676 8:30566463-30566485 CAGAATCACCTGGGGTGGAGGGG - Intronic
1039177900 8:34829970-34829992 GTGAATCAGCTGGAGGGGTGTGG + Intergenic
1042466138 8:69131853-69131875 CTGAATAAATAGGAGTGGGGTGG - Intergenic
1043005688 8:74815413-74815435 CTGATTTAGTAGGACTGGAGTGG - Intronic
1044252413 8:90019369-90019391 TTGAAGCAGCAGCAGTGGAATGG + Intronic
1044432592 8:92126262-92126284 CTAAATCTGCAAGAGTGGAAAGG - Intergenic
1045638400 8:104220317-104220339 CTGAAGCTGCAGGAGGGAAGTGG + Intronic
1045777562 8:105823750-105823772 CTGATTCAGTAGGAGTGGGGAGG + Intergenic
1046255187 8:111687247-111687269 CTGAATCAACAGCTGTGGAATGG + Intergenic
1046957152 8:120073442-120073464 CACAAGCAGCAGGAGGGGAGTGG + Intronic
1047382227 8:124373772-124373794 CTGATTCAGGAGGTGTGAAGTGG - Intergenic
1047486166 8:125333103-125333125 CTGATTCGGCAGGTCTGGAGTGG - Intronic
1048047791 8:130789847-130789869 CTGAGTCAGTAGGACTGAAGGGG - Intronic
1048139769 8:131782901-131782923 CTGAGTCAGCAGGTCTGGTGTGG - Intergenic
1048188567 8:132266726-132266748 CTGAATCAGAAAGTCTGGAGTGG - Intronic
1049005036 8:139849446-139849468 CAGAACCAGAAGGAGAGGAGAGG - Intronic
1049044373 8:140137605-140137627 CTGATTCAGCAGGTGCGGGGTGG - Intronic
1049306319 8:141906201-141906223 TTAAAGCAGCAGGTGTGGAGGGG + Intergenic
1049444658 8:142624448-142624470 CAGAAAGAGGAGGAGTGGAGAGG + Intergenic
1049589002 8:143447120-143447142 CTGAATCAGCACAGGTGGTGAGG - Intronic
1050112571 9:2231991-2232013 CTGATTCAGTAGGTCTGGAGTGG + Intergenic
1050523875 9:6528640-6528662 GTGAAGCAGCGGGAGTGGAGAGG - Intergenic
1050644667 9:7706411-7706433 CTGATTCAGCAGATGTGGGGTGG - Intergenic
1050968819 9:11842956-11842978 TTCCATCAGCAGGAGTCGAGAGG + Intergenic
1051125587 9:13800924-13800946 CTGATTTAGTAGGACTGGAGTGG - Intergenic
1051820455 9:21160249-21160271 GTGAAGCAGTGGGAGTGGAGAGG + Intergenic
1053287783 9:36861017-36861039 GGGAGTCAGCAGGAGGGGAGGGG + Intronic
1054152655 9:61617957-61617979 CTGTTTCAGCAGGAGTTGTGGGG + Intergenic
1054865853 9:70000253-70000275 CTGAATCAGTAGGACTAGAGTGG - Intergenic
1055515601 9:77030231-77030253 CTGACTCAGCAGATGTGGAGTGG + Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1055931436 9:81563506-81563528 CTGATTCAGTTGGACTGGAGTGG - Intergenic
1056459059 9:86791728-86791750 CTGAGTCAGTAGGTCTGGAGGGG - Intergenic
1056905873 9:90647251-90647273 CTGAATCAGTAGGTCCGGAGTGG + Intergenic
1057034458 9:91801664-91801686 CGGAATCCCCAGGAGGGGAGAGG + Intronic
1058528024 9:105879384-105879406 AGGAAACAGCAGGAGGGGAGTGG - Intergenic
1058734664 9:107883370-107883392 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
1059048745 9:110899659-110899681 CTGATTCAGTAGGTCTGGAGTGG + Intronic
1059204964 9:112455973-112455995 ATGATTCAGCAGGTCTGGAGTGG + Intronic
1059379472 9:113912025-113912047 CTGATTCAGCAGGTGTGGGCGGG + Intronic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1060529025 9:124337098-124337120 CTGATTTAGCAGGTCTGGAGTGG - Intronic
1060745689 9:126129344-126129366 CTGAGTCAGACGGAGTAGAGTGG - Intergenic
1061398884 9:130357778-130357800 CAGAATCAGGAGGAGTACAGTGG - Intronic
1061639112 9:131937382-131937404 CTGAATTAGCGGGGGTGGATGGG + Intronic
1062131841 9:134899982-134900004 CTGACACTGCAGGAGTAGAGGGG - Intergenic
1062429380 9:136520173-136520195 TTGAACCAGCGGGAGTTGAGTGG - Intronic
1203719083 Un_GL000216v2:31-53 ATGAATCAACACGAGTGGAATGG - Intergenic
1203719498 Un_GL000216v2:2995-3017 TTGAATCAACCCGAGTGGAGTGG - Intergenic
1203719569 Un_GL000216v2:3466-3488 TTGAATCAGCCTGAGTGGAATGG - Intergenic
1203719710 Un_GL000216v2:4469-4491 TTGAATCAGCCTGAGTGGAATGG - Intergenic
1203719906 Un_GL000216v2:5861-5883 TTGAATCAACACGAGTGGAGTGG - Intergenic
1203720045 Un_GL000216v2:6820-6842 ATGAATCAACCGGAGTGGAATGG - Intergenic
1203720540 Un_GL000216v2:10284-10306 TTGAATCAACACGAGTGGAATGG - Intergenic
1203720558 Un_GL000216v2:10409-10431 TTGAATCAACACGAGTGGAATGG - Intergenic
1203721598 Un_GL000216v2:17335-17357 TTGAATAAGCACGAGTGGAGTGG - Intergenic
1203721704 Un_GL000216v2:18099-18121 TTGAATCAACATGAGTGGAATGG - Intergenic
1203721802 Un_GL000216v2:18779-18801 TTGAATAAGCACGAGTGGAGTGG - Intergenic
1203721868 Un_GL000216v2:19278-19300 TTGAATCAACATGAGTGGAATGG - Intergenic
1203721872 Un_GL000216v2:19323-19345 TTGAATCAACATGAGTGGAAGGG - Intergenic
1203721911 Un_GL000216v2:19553-19575 TTGAATCAACACGAGTGGAGTGG - Intergenic
1203722760 Un_GL000216v2:25672-25694 TTGAATCAACACGAGTGGAGTGG - Intergenic
1203722971 Un_GL000216v2:27048-27070 TTGAATCACCAGCAGTGGAATGG - Intergenic
1203723091 Un_GL000216v2:27872-27894 TTGAATCAACATGAGTGGAATGG - Intergenic
1203723191 Un_GL000216v2:28552-28574 TTGAATAAGCACGAGTGGAGTGG - Intergenic
1203723298 Un_GL000216v2:29321-29343 TTGAATCAACACGAGTGGAGTGG - Intergenic
1185922507 X:4109244-4109266 CAGATTCAGCAGCATTGGAGTGG - Intergenic
1186326319 X:8481164-8481186 CTGATTCAGCAGGGATGGGGTGG + Intergenic
1186587904 X:10896436-10896458 CTGATTCAGTAGGTTTGGAGTGG - Intergenic
1186708930 X:12172545-12172567 CTGATTCAGCAGGTCTGGGGTGG + Intronic
1186908589 X:14137547-14137569 CTGAATCAGCAGGTGTGGAATGG + Intergenic
1187292381 X:17967487-17967509 CTGATTCAGCAGCTCTGGAGTGG + Intergenic
1187345782 X:18462411-18462433 CTGAATCAGTAGGTCTGGAGTGG - Intronic
1187369947 X:18696912-18696934 GTGAAGCAGCTGGACTGGAGAGG - Intronic
1188546013 X:31308124-31308146 CTGGAACAGCAGGAGGTGAGTGG - Intronic
1188820775 X:34772047-34772069 TTGACTCAGCAGAAATGGAGAGG - Intergenic
1189050869 X:37644259-37644281 CTGACTCAGTAGCTGTGGAGTGG - Intronic
1189617897 X:42803052-42803074 CTGACACAGCAGGTCTGGAGTGG + Intergenic
1193328168 X:80206719-80206741 CTGTATCAGAATGAGTGAAGAGG - Intergenic
1195266525 X:103186140-103186162 AGGAATGAGCAGGAGTTGAGGGG - Intergenic
1195713324 X:107793251-107793273 CTGATTCAGTAGGTTTGGAGAGG - Intronic
1195935998 X:110126271-110126293 CTGGATCAGGAGGAGAGGGGTGG - Intronic
1196742367 X:119036528-119036550 CTAAGTCAGAAGGGGTGGAGAGG - Intergenic
1196948764 X:120854812-120854834 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1197961000 X:132006132-132006154 CTGATTCAGTAGGTCTGGAGTGG - Intergenic
1198562058 X:137861090-137861112 CTGATTCAGTAGAAGTGGGGTGG + Intergenic
1199933792 X:152551664-152551686 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1201115683 Y:10833555-10833577 CTGAATGGGAAGGAGTTGAGTGG - Intergenic
1201134239 Y:10978332-10978354 TGGAATCAACAGGAGTGGAGTGG - Intergenic
1201137378 Y:11000235-11000257 CTGAATGGGCTGGAGTGGAGTGG - Intergenic
1201141617 Y:11033217-11033239 CTGAATGAGAAGGAATGGAATGG - Intergenic
1201174552 Y:11300272-11300294 TTGAATCAACTTGAGTGGAGTGG - Intergenic
1201470658 Y:14331145-14331167 CTGATTCAGTAGGTCTGGAGTGG + Intergenic
1201636471 Y:16128289-16128311 CTGAAGCTGCATGAGGGGAGGGG - Intergenic
1201641837 Y:16187880-16187902 CTGATACAGCAGAAGTGGAAGGG + Intergenic
1201660978 Y:16397441-16397463 CTGATACAGCAGAAGTGGAAGGG - Intergenic
1202611279 Y:56681153-56681175 TTGAATCAACAGGAATGGAAGGG + Intergenic
1202611700 Y:56684737-56684759 TTGAATCAACAGGAATGGAAGGG + Intergenic
1202612538 Y:56691874-56691896 TTGAATCAACAGGAATGGAAGGG + Intergenic
1202612958 Y:56695433-56695455 TTGAATCAACAGGAATGGAAGGG + Intergenic
1202613798 Y:56702591-56702613 TTGAATCAACAGGAATGGAAGGG + Intergenic
1202614220 Y:56706160-56706182 TTGAATCAACAGGAATGGAAGGG + Intergenic
1202616303 Y:56723965-56723987 TTGAATCAACAGGAATGGAAGGG + Intergenic
1202617147 Y:56731141-56731163 TTGAATCAACAGGAATGGAAGGG + Intergenic
1202619243 Y:56749007-56749029 TTGAATCAACAGGAATGGAAGGG + Intergenic
1202620076 Y:56756045-56756067 TTGAATCAACAGGAATGGAAGGG + Intergenic
1202620492 Y:56759594-56759616 TTGAATCAACAGGAATGGAAGGG + Intergenic