ID: 1102205891

View in Genome Browser
Species Human (GRCh38)
Location 12:111090563-111090585
Sequence TAGTGTAGTAAAGGGATCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102205891_1102205896 27 Left 1102205891 12:111090563-111090585 CCTGCGATCCCTTTACTACACTA 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1102205896 12:111090613-111090635 ATTTCCACCTCCCCATCTCTCGG 0: 1
1: 0
2: 1
3: 35
4: 330
1102205891_1102205895 2 Left 1102205891 12:111090563-111090585 CCTGCGATCCCTTTACTACACTA 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1102205895 12:111090588-111090610 CTTTGGTCTCTGTAAAACAGAGG 0: 1
1: 0
2: 0
3: 23
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102205891 Original CRISPR TAGTGTAGTAAAGGGATCGC AGG (reversed) Intronic
906908739 1:49923948-49923970 TACTCTAGTAATGGGATTGCTGG - Intronic
1070568753 10:77624766-77624788 GAGTGAAGTTAAGGGAGCGCCGG - Intronic
1073485385 10:103814552-103814574 TTGTGAAGTAATGGGATGGCTGG + Intronic
1075207587 10:120460402-120460424 TAGTGTAGAAATGAGATGGCTGG + Intronic
1077977037 11:7257911-7257933 AATTGTAGTAAAGGCATCACAGG + Intronic
1080079491 11:28199375-28199397 CAGTGAAGTGAAGGGATTGCTGG - Intronic
1081368369 11:42265283-42265305 TAGTGTTGCGAAGGGTTCGCTGG - Intergenic
1082938996 11:58684200-58684222 TAGTGCTGCAAAGGGATTGCTGG - Intronic
1085011722 11:73145983-73146005 TAGTGAAGGAAAGGGAGGGCTGG + Intergenic
1089601189 11:119616421-119616443 TTGTGTAGGAACAGGATCGCTGG + Intergenic
1090131472 11:124146694-124146716 TAGTGCAGTAAAGGGAAGGGTGG + Exonic
1094769374 12:33636572-33636594 TAGTTTAATAAAGAGATGGCTGG - Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1102205891 12:111090563-111090585 TAGTGTAGTAAAGGGATCGCAGG - Intronic
1104245867 12:127040943-127040965 TAGTGGAGGAAAGGCATCTCTGG + Intergenic
1109609791 13:64749636-64749658 AAGTGTATTAAAGGGAAAGCAGG + Intergenic
1115821680 14:37219302-37219324 TAGTATAGTAAAGGGTTCAAAGG + Intronic
1124932011 15:34129613-34129635 TAGTGTAGAAAAGGAATTGCAGG - Intergenic
1128086176 15:64888321-64888343 TAGTGTAGTAAGGGGGCTGCAGG + Intronic
1128526887 15:68418583-68418605 TTGTGTAGTAAAGTGACCTCAGG - Intronic
1128771775 15:70288278-70288300 TAGAGTATTGAAGGGATGGCAGG - Intergenic
1130060390 15:80565368-80565390 TAATGCAGTAATGGGATTGCTGG + Intronic
1155340522 18:24809887-24809909 TTGTGTAGTAAAGGGTTACCAGG - Intergenic
1155471711 18:26198922-26198944 TAGTGTAGGAATGGAATTGCAGG - Intergenic
1160606504 18:80054653-80054675 TTGGGTAGTAGTGGGATCGCTGG - Intronic
933729772 2:85447677-85447699 CAGTGTAGGCAAGGGCTCGCTGG + Intergenic
939876196 2:147580971-147580993 TAACCTAGTAAAGGGATTGCTGG + Intergenic
945789020 2:214280045-214280067 TAGTGTCTTAAAGTGATCGTTGG - Intronic
947979427 2:234396318-234396340 TGGTGTGGTAAAGCGATCCCTGG - Intergenic
1171322644 20:24259896-24259918 TAGTGTAGGAAAGGTTTAGCAGG + Intergenic
1175679984 20:60979115-60979137 TGGAGTAGTAAAGTGATCACTGG - Intergenic
955469513 3:59272081-59272103 TAATGTAGTAAAGGGATGAAGGG - Intergenic
955793675 3:62613158-62613180 TAGTGTACTAAAGGGATAACAGG + Intronic
964611998 3:158624933-158624955 AAGTGTTCTAAAGGGGTCGCAGG + Intergenic
967172512 3:186833042-186833064 TAGTGTGGTAATGGGAACTCTGG - Intergenic
972172903 4:36368538-36368560 TAGTGCAGTATAGGGATCACTGG + Intergenic
974125233 4:57687935-57687957 CAGTGAGGTAAAGGGATGGCTGG + Intergenic
974366291 4:60953892-60953914 TTTTGTAGTAATGGGATTGCTGG + Intergenic
984836547 4:184027737-184027759 CAGTCCAGTAAAGGGATGGCAGG - Intergenic
985737276 5:1591504-1591526 TAGGGAAGAAAAGGGATTGCTGG - Intergenic
989186732 5:38633223-38633245 TATTTTAGTAAAGGGTTCTCTGG - Intergenic
1001561386 5:172671296-172671318 TAGGGGAGTAAAGGGAGAGCAGG + Intronic
1006297369 6:33175824-33175846 TAGTGTAGTGATGGGAGGGCAGG + Intronic
1008810493 6:55491965-55491987 TAGTGTAGTAGAGGGATCTGAGG - Intronic
1010954193 6:82071498-82071520 CAGGGTAGTAAAGGGATGGGGGG + Intergenic
1017852776 6:158319473-158319495 TAGTGTTCTTAAGGGATGGCCGG - Intronic
1024277866 7:47693613-47693635 TAGTGTTGTAGAAGGATCTCTGG - Intergenic
1030028881 7:105350906-105350928 TAATGTAGTATAGGGTTGGCTGG - Intronic
1031648392 7:124255231-124255253 TAGTTTAGTACAGGGAATGCTGG - Intergenic
1034368056 7:150569194-150569216 TAGAGTAGAAAAGGGATTGAAGG + Intronic
1034595062 7:152181830-152181852 TGGTTTAGTAAAGTGATCACTGG + Exonic
1040067068 8:43154701-43154723 TAATCCAGTAAAGGGATGGCTGG + Intronic
1052993383 9:34535913-34535935 TATTGTAGAAAAGGGACCGTGGG + Intergenic
1059030061 9:110683116-110683138 AAGGGTAGTACAGGGATCGGGGG - Intronic
1059824266 9:118009563-118009585 TATTGTAGTAAAGGGATCTAAGG - Intergenic
1195378949 X:104253716-104253738 TAGCGAAGGAAAGGGGTCGCTGG + Intronic
1196093285 X:111770627-111770649 TAGTGTAGTAAAGAGACAGTTGG - Intergenic
1197595776 X:128462507-128462529 TAGAGTAGTAAAGAGATCCTAGG + Intergenic