ID: 1102205966

View in Genome Browser
Species Human (GRCh38)
Location 12:111091116-111091138
Sequence CCGTGTGCACATCCATGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102205962_1102205966 14 Left 1102205962 12:111091079-111091101 CCAGGAATTCAGTCACTCTCAGC 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1102205966 12:111091116-111091138 CCGTGTGCACATCCATGTAAGGG 0: 1
1: 0
2: 1
3: 6
4: 78
1102205961_1102205966 21 Left 1102205961 12:111091072-111091094 CCTTGAGCCAGGAATTCAGTCAC 0: 1
1: 0
2: 2
3: 16
4: 225
Right 1102205966 12:111091116-111091138 CCGTGTGCACATCCATGTAAGGG 0: 1
1: 0
2: 1
3: 6
4: 78
1102205963_1102205966 -8 Left 1102205963 12:111091101-111091123 CCTCAGTTTGCACATCCGTGTGC 0: 1
1: 0
2: 0
3: 12
4: 165
Right 1102205966 12:111091116-111091138 CCGTGTGCACATCCATGTAAGGG 0: 1
1: 0
2: 1
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102205966 Original CRISPR CCGTGTGCACATCCATGTAA GGG Intronic
902120840 1:14164258-14164280 CCCTGGGCACATCCATCTGAGGG + Intergenic
902517664 1:16998063-16998085 CTGTGTGCACATTCCTGCAAGGG + Intronic
907326324 1:53640812-53640834 GTGTGTGCACATGCATGAAAGGG - Intronic
915538850 1:156554649-156554671 TCGTGGGCTCATCCATGAAATGG - Intronic
917385376 1:174467097-174467119 GTGTGTGCACATGCATTTAAAGG - Intronic
1065915363 10:30350483-30350505 CCGTGTTCTCATCCATGAAATGG - Intronic
1067712708 10:48662678-48662700 CCCTGTGCACAGCCATGCCATGG + Intergenic
1076919265 10:133442826-133442848 CCGTGGGCACCTCTGTGTAAAGG - Intergenic
1078537339 11:12185585-12185607 CAGTCTGCTCATCCATGAAATGG - Intronic
1083526826 11:63375138-63375160 CAGTGTTCTCATCTATGTAATGG - Intronic
1083625518 11:64070119-64070141 CAGTTTCCACATCTATGTAAGGG - Intronic
1084336478 11:68460812-68460834 TCGTGGGCACCTCCAGGTAATGG + Exonic
1084651498 11:70492043-70492065 CCGTGAGCACATGGAAGTAAGGG - Intronic
1093930779 12:24953365-24953387 GTGTGTGCACATGTATGTAATGG - Intergenic
1101454575 12:104816748-104816770 TCCTGCGCAAATCCATGTAAGGG - Intronic
1102205966 12:111091116-111091138 CCGTGTGCACATCCATGTAAGGG + Intronic
1102781882 12:115572578-115572600 CAGTGTTCACATCTATGAAATGG - Intergenic
1102954569 12:117051183-117051205 ACGACTGCACCTCCATGTAAAGG + Intronic
1111750482 13:92325201-92325223 CCGTATACACATCAATCTAATGG + Intronic
1112212807 13:97397948-97397970 CCATGTTCACATCCCTTTAATGG - Intergenic
1112386134 13:98941463-98941485 TCGTGTGCTCTTCCATTTAAGGG - Intronic
1113885054 13:113654452-113654474 CCGTGTGCATATCCAAGCACAGG + Intronic
1119683135 14:76607758-76607780 ACGTGTGCACACACATGTCAGGG + Intergenic
1127897864 15:63318230-63318252 CTGTGTGCTCCTCCATGGAAAGG + Intergenic
1129329336 15:74818986-74819008 CCCAGAGCACATACATGTAAGGG + Intronic
1134656942 16:15954445-15954467 CAGTGTCCACATCCACGAAATGG - Intronic
1135048600 16:19174031-19174053 CCGTCTACCCATCCATGCAATGG - Intronic
1137370844 16:47904376-47904398 CCCAGAGCACATCCATGTAATGG + Intergenic
1138307724 16:55993431-55993453 CCTTGTGCACATCCCTGGGATGG - Intergenic
1140520068 16:75573230-75573252 CCATTTGCATATCCATTTAATGG + Intronic
1141413333 16:83851435-83851457 CCATGTGCACATCCATCTATGGG - Intergenic
1157678515 18:49585638-49585660 CCTTGTGCACATGTGTGTAAGGG + Intronic
927480627 2:23451259-23451281 CCCTGGGTAAATCCATGTAAAGG + Intronic
931796082 2:65711533-65711555 CCATGTGCACACCCATGTGCAGG - Intergenic
933384729 2:81595999-81596021 CAGTGGGTACATCCATATAAAGG - Intergenic
935702413 2:105824041-105824063 CCCTGGCCACATCCCTGTAAGGG - Intronic
942794156 2:179796400-179796422 CTGTGTGCACATGCATGATAAGG + Intronic
947163888 2:227241883-227241905 CCGTTTTCTCATCCATGTAGTGG - Intronic
948501785 2:238399745-238399767 CGGTATGCACACCCATGCAAAGG - Exonic
1169034756 20:2440625-2440647 CCATGTGCACAACCACATAAAGG + Intergenic
1169446629 20:5677251-5677273 CCGTTTGCACATGCTTGTCAAGG - Intergenic
1169570216 20:6898066-6898088 CCCTGTGCAAATCCATGTCAAGG + Intergenic
1174374129 20:50114161-50114183 CAGTGTCTACATCCATATAAGGG - Intronic
1175244772 20:57575275-57575297 CCATCTGTACATCCATCTAATGG + Intergenic
1178724497 21:35038847-35038869 CAATGTGCACATCCATGCAGAGG - Intronic
949975930 3:9459318-9459340 GCTTGTGCACATACTTGTAATGG + Intronic
954256332 3:49409792-49409814 CCCTGTGCACATGCATGTGGTGG - Intronic
955231675 3:57104926-57104948 TCCTGTGAACATCCATGAAACGG + Intronic
955600277 3:60637652-60637674 CAGTGTTCACATCTATGAAATGG - Intronic
958145812 3:89623217-89623239 CTGTGTACAAATCAATGTAAGGG + Intergenic
961376967 3:126473767-126473789 CCGTGTGCATATACAGGTTAGGG + Intronic
961523320 3:127480875-127480897 CCGTGTGCTCATCCATGTGATGG + Intergenic
966023036 3:175239809-175239831 CAGTGTTCTCATCCATATAAGGG + Intronic
968442380 4:630389-630411 CCGAGTGCCCATCCATGCAAGGG + Intronic
968661932 4:1802260-1802282 CCGTGGGCAGCTCCATGTCAGGG - Intronic
974634626 4:64545216-64545238 CAGTGTGTTCATCCATATAATGG + Intergenic
982224667 4:153154441-153154463 CCGTTTCCTCATCCATATAATGG + Intronic
986596567 5:9429029-9429051 TCCTGTGCACATCCCTGCAATGG - Intronic
991274965 5:64835363-64835385 CTTTATGGACATCCATGTAAAGG - Intronic
993935311 5:93992995-93993017 TCGTGTGCAGATCCCTGGAAAGG - Intronic
998812296 5:145978410-145978432 CCCTGTGGACATCCCTGCAAAGG - Intronic
1002460260 5:179369738-179369760 TCGTGTGCACATCCCTGGAGAGG - Intergenic
1003389522 6:5701248-5701270 CCGTGTGCACATCTCTGCAAAGG + Intronic
1003672155 6:8169751-8169773 CCGTGTCCTCATTCATATAATGG + Intergenic
1004164382 6:13242880-13242902 CTGTGTGCACAGCTCTGTAATGG + Intronic
1006428018 6:33978261-33978283 CAGTCTGCTCATCCGTGTAATGG - Intergenic
1010355163 6:74923726-74923748 CCCATTGCACATCCATTTAAAGG - Intergenic
1015002773 6:128239910-128239932 GCGTGTGCACACGCATGTAGTGG - Intronic
1017754479 6:157518001-157518023 GCGTGTCCACATCCATGCACGGG - Intronic
1019321648 7:418717-418739 CTGTGTGCTCATCCCTGAAATGG - Intergenic
1023593171 7:41800190-41800212 CCTTGTGCCTGTCCATGTAATGG - Intergenic
1024234467 7:47387507-47387529 GAGGGTGCACCTCCATGTAAGGG + Intronic
1025994272 7:66518385-66518407 CAGTCTGCACATCCCTGCAATGG - Intergenic
1026033727 7:66816280-66816302 CGGTCTGCACATCCCTGCAATGG + Intergenic
1033473983 7:141673076-141673098 CCGTGTCCACATCTCTGCAAAGG + Intronic
1033477238 7:141702355-141702377 CCGTGTGCACGTCCGTGTGTGGG + Intergenic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1040728738 8:50416288-50416310 ACATGTGCACATGCATGGAATGG + Intronic
1048427769 8:134338645-134338667 GGGTGTGCACATCCATGTGCGGG - Intergenic
1057362828 9:94390625-94390647 ACATGTGCACATCCATATATGGG - Intronic
1057660510 9:96997468-96997490 ACATGTGCACATCCATATATGGG + Intronic
1058945061 9:109848227-109848249 CAGTGTGCACATCTGTGAAAGGG - Intronic
1061788222 9:133043741-133043763 CCGTATGCACAGCCAAGTACTGG - Exonic
1061901147 9:133672712-133672734 CCGTGAGCACAACCATGTTCTGG + Intronic
1199921822 X:152414167-152414189 TGGTGTGAACATCCATGTACAGG - Intronic
1201464301 Y:14263445-14263467 GTGTGTGCACGTGCATGTAAGGG - Intergenic