ID: 1102209624

View in Genome Browser
Species Human (GRCh38)
Location 12:111116328-111116350
Sequence CAGAATATTGAGAAGTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102209624 Original CRISPR CAGAATATTGAGAAGTGGTG AGG Intronic
902198822 1:14818724-14818746 CAGAACTTTGAGAAGGGGTGAGG + Intronic
905637486 1:39564562-39564584 CACATCATTGAGAAGTGATGTGG + Intronic
906636757 1:47415583-47415605 CAGAATTGTGGAAAGTGGTGCGG - Intergenic
907972013 1:59392366-59392388 CACAAGATACAGAAGTGGTGTGG + Intronic
909245290 1:73273631-73273653 CAGAATACTTAGAAATGGTTTGG - Intergenic
911439891 1:97912831-97912853 CCAAATATTGAGGAGTGCTGGGG - Intronic
911766249 1:101678534-101678556 CAAAATATACAGTAGTGGTGGGG + Intergenic
913451259 1:118994166-118994188 CAGGACAGTGAGAAATGGTGGGG + Intergenic
916385360 1:164261311-164261333 AAGAATAATGAGAAGATGTGAGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917144898 1:171879401-171879423 CAAAATAATGTAAAGTGGTGTGG - Intronic
918829589 1:189376662-189376684 CAGCATAGAGTGAAGTGGTGTGG + Intergenic
919481662 1:198097592-198097614 CACAACATTGAGAAGTGGAAGGG + Intergenic
921061737 1:211590978-211591000 CAGAATATTGAGAGTTGGCTAGG - Intergenic
921451167 1:215307402-215307424 AACAATATTGAGAGGTGGAGGGG - Intergenic
922873062 1:228918589-228918611 CAGAAAGGTGTGAAGTGGTGTGG + Intergenic
1065936712 10:30526800-30526822 CAGAATTTTGAGAATTGATACGG - Intergenic
1066395786 10:35020258-35020280 AAGAATGCTGAGAAGTGGGGAGG + Intronic
1066648578 10:37634941-37634963 CAGAAGAATGAGGGGTGGTGAGG + Intergenic
1067031452 10:42880627-42880649 CAGAAGAATGAGGGGTGGTGAGG + Intergenic
1068873077 10:61966267-61966289 CAGAAAGTTAAAAAGTGGTGAGG + Intronic
1070247321 10:74744551-74744573 AAGAATGAGGAGAAGTGGTGCGG - Intergenic
1071235814 10:83646897-83646919 CAAAATTTTGAGAGGAGGTGGGG + Intergenic
1071267822 10:83979938-83979960 CACAAGCTTGAGAAGTTGTGGGG - Intergenic
1072184339 10:93020871-93020893 CAAAGTATTGAGAGATGGTGGGG - Intronic
1073744569 10:106451375-106451397 GATAATATTGAGAGATGGTGAGG + Intergenic
1074662311 10:115674761-115674783 TAGAAAAGTGAGATGTGGTGTGG - Intronic
1078384340 11:10874620-10874642 CAGAATTTTGAGACTTGGGGTGG - Intergenic
1079104265 11:17560435-17560457 CAGGCTTTTGAGAGGTGGTGAGG + Intronic
1079398395 11:20085741-20085763 CAGAATGTTGAGCAGTGGACTGG - Intronic
1080945569 11:36969865-36969887 CAGAATATTGAAAAACGGTATGG + Intergenic
1081072917 11:38632100-38632122 CATAATATAGAGATGTGCTGAGG - Intergenic
1083579569 11:63816224-63816246 GGGAATATTGAGAAGAGATGAGG + Intronic
1086634996 11:89071123-89071145 CAGAATTTTGAAAATTGATGAGG + Intergenic
1086864931 11:91969547-91969569 AAGAAGATTGAGCAGTGGTAGGG - Intergenic
1089024203 11:115251442-115251464 CAGAAAATTGGGAAGTGGGAGGG + Intronic
1089153386 11:116382503-116382525 CAGAATATTGAGAAGTGTGGAGG + Intergenic
1089733517 11:120534373-120534395 CAGGATAGAGACAAGTGGTGGGG + Intronic
1090111056 11:123909947-123909969 CAAAAAATTCAGATGTGGTGTGG + Intergenic
1092822431 12:12365137-12365159 AAGAACATTGAGAATAGGTGAGG + Intronic
1093287110 12:17277367-17277389 CAGAAAAGTGAGGAGTGGGGAGG + Intergenic
1096327080 12:50673494-50673516 AAGAATCTTGAGACCTGGTGTGG + Intronic
1098198423 12:68027421-68027443 GAGAAAATTGAGGGGTGGTGGGG + Intergenic
1100355975 12:93830049-93830071 CAGGAAATTGACCAGTGGTGGGG + Intronic
1101336715 12:103803082-103803104 CAGAATAGAGAGACCTGGTGAGG + Intronic
1101608986 12:106273063-106273085 CAGAACATTGATCAGTGGAGAGG - Intronic
1102209624 12:111116328-111116350 CAGAATATTGAGAAGTGGTGAGG + Intronic
1103148775 12:118618794-118618816 TGGATTATTGAAAAGTGGTGTGG + Intergenic
1103853907 12:123951270-123951292 TGGAATATTGAGAAATGATGGGG - Intronic
1103863745 12:124034841-124034863 CAGACTCTTGAGATGTGATGTGG + Intronic
1104808040 12:131601937-131601959 CAGAATTTTGTGCAGGGGTGAGG - Intergenic
1107310703 13:39074034-39074056 CAGCACATTGAGAAGGGGGGTGG - Intergenic
1107791029 13:44002441-44002463 CAGAATAATGGGAAATAGTGTGG - Intergenic
1108905388 13:55464716-55464738 CAGAATCTTGGGAAGTGAAGAGG - Intergenic
1110283818 13:73726242-73726264 CATAATATTAAGAAGTGCTGGGG - Intronic
1110596283 13:77324111-77324133 CAGAATAGAGGGATGTGGTGAGG - Intronic
1111018281 13:82410235-82410257 CTTAATACTGGGAAGTGGTGGGG - Intergenic
1112229014 13:97569079-97569101 CACAATCATGGGAAGTGGTGGGG - Intergenic
1112379039 13:98871265-98871287 TAGAACATTGACAAGTGGGGAGG + Intronic
1113317576 13:109199085-109199107 CTGAATATTGAGAAGTGAGATGG - Intronic
1113997074 14:16097441-16097463 CAGAATGTGGAGATGTGGAGTGG - Intergenic
1114363312 14:22000022-22000044 CACTATACTGAGAAGTGATGGGG - Intergenic
1115818003 14:37183719-37183741 CAGTCTATTGTGCAGTGGTGTGG - Intergenic
1116982908 14:51190271-51190293 CAGAATATAGTGAAGTGATATGG + Intergenic
1118441256 14:65813784-65813806 CAGGATAACGTGAAGTGGTGGGG + Intergenic
1119905201 14:78295661-78295683 CAGAATTTTGGGAAGGAGTGGGG - Intronic
1124208507 15:27743330-27743352 CACACTCTTGAGAAGGGGTGGGG + Intergenic
1127218911 15:56856377-56856399 GAGAATATTCAGAAGGAGTGAGG - Intronic
1127367630 15:58306332-58306354 CAAAATCTACAGAAGTGGTGTGG - Intronic
1128378457 15:67093870-67093892 CAGAGTTCTGTGAAGTGGTGCGG + Intronic
1129143966 15:73631897-73631919 GAGAAGATGGAGAAGTGGTGGGG - Intronic
1131940485 15:97559601-97559623 CAGAAGATGTAGAAGTGGTATGG - Intergenic
1132967316 16:2665395-2665417 CATAATATTGACAAATAGTGGGG + Intergenic
1133937947 16:10284138-10284160 CAGGAAAGTGAGAAGGGGTGGGG - Intergenic
1137750523 16:50858182-50858204 CTGAGTGTAGAGAAGTGGTGGGG + Intergenic
1138153550 16:54681920-54681942 CAAAAGACTGAGAAGGGGTGTGG - Intergenic
1138823857 16:60294626-60294648 CAGCACTTTGAGAAGTGGTTTGG - Intergenic
1141154214 16:81585813-81585835 CCGAATCTTGAGAAGTGAGGAGG - Intronic
1149622741 17:58058503-58058525 CAGAATTTCTAGAACTGGTGTGG - Intergenic
1150007354 17:61478118-61478140 AAGGGTATTGAGAAGAGGTGAGG + Intronic
1151334235 17:73430633-73430655 CAGCATGGTGAGAAGAGGTGTGG + Intronic
1151591626 17:75047867-75047889 GAGAATATGGAGAAGGGGTGTGG - Intronic
1155306958 18:24487956-24487978 CAAAATATTGAGAAGTGAGTGGG - Intergenic
1156073513 18:33243230-33243252 GAGAATACTGAAAAGTGGGGTGG + Intronic
1163666023 19:18604430-18604452 GAGAAAATTGAGAACTGGAGAGG - Intronic
1164084003 19:21885375-21885397 CATAATATTGACAAATAGTGGGG + Intergenic
1165652447 19:37503096-37503118 CAGAGTATTGAGTAATGATGTGG - Intergenic
1166237187 19:41465131-41465153 CCTAATATCCAGAAGTGGTGAGG - Intergenic
1166244962 19:41518783-41518805 CCTAATATCCAGAAGTGGTGAGG - Intergenic
927871624 2:26627771-26627793 CAAAATAATGAGAAAGGGTGAGG - Intronic
929278588 2:40052835-40052857 CAGATTATGTAGAAGTGGGGAGG + Intergenic
929857186 2:45647276-45647298 CAGAATATAGAGCAGAGATGGGG + Intergenic
931250666 2:60528273-60528295 CGGACTTTTAAGAAGTGGTGAGG - Intronic
931868197 2:66433808-66433830 GAGAATAAAGAGAAGGGGTGAGG + Intronic
932966818 2:76485622-76485644 CATAGTAATGTGAAGTGGTGAGG - Intergenic
933727491 2:85435032-85435054 CAGATTATTGAGCTGGGGTGGGG - Exonic
933762480 2:85681834-85681856 CAGAGTTTTGAGAAGTTATGTGG + Intergenic
938989431 2:136612730-136612752 CAGAACATTGTGAAGGGGAGAGG + Intergenic
939120188 2:138107221-138107243 CAGAATATAGAGATGAGGTTTGG + Intergenic
939624314 2:144458179-144458201 CAGAAAAGTGTGAAGTTGTGTGG - Intronic
940100112 2:150027477-150027499 CAGAATCTTAGGAAGTTGTGGGG - Intergenic
940513940 2:154655977-154655999 CTGAATATTAAGAAAGGGTGAGG - Intergenic
941418218 2:165248211-165248233 CAGAATTTTGAGCAGGGATGTGG - Intronic
943769156 2:191696021-191696043 CAGAAGATTGAAAAGTGCTTGGG + Intronic
943904018 2:193474972-193474994 CAGGATATTGAGAAGTACAGAGG - Intergenic
944437654 2:199707206-199707228 CAGAAAATTGAGGAGTGGGGAGG - Intergenic
944682365 2:202088723-202088745 TAGACGATTGAGAAGTGGTGGGG + Intronic
945682107 2:212926660-212926682 CCGAATATTCAGAAGGGGAGGGG + Intergenic
947123810 2:226845577-226845599 CAGAATATAAAGAAGTTGTCAGG - Intronic
947848961 2:233268810-233268832 CAGAATCTTGGGAAGGGATGTGG - Intronic
948591202 2:239051480-239051502 CAGAAAATTGCTAAATGGTGAGG + Exonic
1169046528 20:2537987-2538009 CAGAATCTTGGGGAGTGATGGGG + Intronic
1170023455 20:11862907-11862929 AACACTATTGAGAGGTGGTGTGG + Intergenic
1170654496 20:18273403-18273425 CAGAAAATTGAAAAGAGGTGAGG + Intergenic
1174776266 20:53345783-53345805 CAGGATGCTGAGAAGTGGGGAGG - Intronic
1174902969 20:54520466-54520488 CAGAATTTTGAGCAGAGGAGTGG - Intronic
1174926166 20:54762451-54762473 CAAAATATTGATAAGTGAAGTGG - Intergenic
1177656294 21:24020944-24020966 CAGAATTTTGAGGACTGTTGGGG + Intergenic
1177670151 21:24214398-24214420 CAGACTATTGATAACTGGGGCGG + Intergenic
1178039761 21:28627470-28627492 CAGGATATTGAAACGTGGGGAGG - Intergenic
1179424088 21:41259632-41259654 CAGGATAATGAGTAGTGCTGGGG - Intronic
1180338208 22:11598414-11598436 CAGAAGAGTGAGAGGTGGAGGGG - Intergenic
1180914330 22:19474762-19474784 CAGAATACTGAGAACAGTTGGGG + Intronic
1180959462 22:19756057-19756079 CAGAATTCTGAGCAGTGGGGAGG + Intergenic
1181279327 22:21707647-21707669 CAGAATATTGAAGACTGATGAGG - Intronic
1183040792 22:35176416-35176438 TACAGTATTGAGAGGTGGTGAGG - Intergenic
950785901 3:15435304-15435326 CAGACTCTTTAGAAGTTGTGAGG + Intronic
951295742 3:20932337-20932359 TAGAAAATTGAAAAGGGGTGGGG + Intergenic
952167978 3:30772394-30772416 CAGAATACTGAGTAATGATGGGG + Intronic
952189824 3:31010769-31010791 CAGAATATTGGGAATTTTTGAGG + Intergenic
952546230 3:34422514-34422536 CTGAATATTGAGTATTGGGGTGG + Intergenic
956654025 3:71531912-71531934 CAGAGTATTCTGAAATGGTGGGG - Intronic
956689737 3:71864536-71864558 CCGAATATTGAGAGAGGGTGGGG + Intergenic
956715712 3:72078135-72078157 GAGAAAAGTGAGAAGCGGTGAGG + Intergenic
956813975 3:72891002-72891024 CAGAAGATTCTGAAGTTGTGAGG + Intronic
959429700 3:106237446-106237468 CAAAAAATTGAGGAGTGGAGGGG - Intergenic
960162168 3:114362153-114362175 CTGAATGTTGAGGAGTGTTGGGG + Intronic
965364547 3:167782785-167782807 CAGAACCTTGAGAAGTGCTTTGG + Intronic
965664321 3:171076207-171076229 CACAATATTAGGAAGTGTTGGGG - Intronic
966074071 3:175915343-175915365 GAGAACATTGTGAAGTGGAGTGG + Intergenic
966634177 3:182113858-182113880 CAGAATTTAGATAAGGGGTGAGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
968141074 3:196257406-196257428 CAGAACGTAGAGAGGTGGTGGGG + Intronic
970516471 4:16835938-16835960 CAGAACATTCAGGAATGGTGGGG + Intronic
970713121 4:18887663-18887685 GAGGATATTGGGAGGTGGTGGGG + Intergenic
972930161 4:44062674-44062696 CAGAATATTGGTAAATGGAGTGG + Intergenic
974013596 4:56629223-56629245 CAGAAAATAGATAAGTGGTTGGG + Intergenic
974982871 4:68982127-68982149 CAGTAAATTGAAAACTGGTGAGG - Intergenic
975720752 4:77246555-77246577 CAGAAGTTCCAGAAGTGGTGGGG - Intronic
977889456 4:102291465-102291487 CTGAAGATAGAGAACTGGTGTGG - Intronic
980363312 4:131765274-131765296 AAGAAGAGTGAGAAGTGGGGAGG + Intergenic
982872648 4:160603023-160603045 CAGAATTTTGTGAATTGTTGAGG - Intergenic
985147062 4:186904226-186904248 ATAAATATTGAGAAGTGGTGTGG - Intergenic
985326688 4:188778519-188778541 AAGAACAGTGAGAAATGGTGCGG + Intergenic
986529011 5:8714242-8714264 GACAATATTGAGAAGTTCTGTGG - Intergenic
989022808 5:37029701-37029723 GACAATAATGAGAACTGGTGAGG - Intronic
990196053 5:53317715-53317737 TAAAATTTTGAGAAGTGGGGAGG + Intergenic
992064623 5:73094725-73094747 CACAATATTTAGAAGTTCTGGGG + Intergenic
992270470 5:75057575-75057597 CAGAACACTGAGAAGTTGAGGGG + Intergenic
994392483 5:99203869-99203891 CAGAATATTCAGAAGGGTAGAGG - Intergenic
994923602 5:106084422-106084444 CAGATTACTTACAAGTGGTGTGG - Intergenic
995311846 5:110722083-110722105 CAGAAGATAGAGATGTGGTAGGG + Intronic
995516376 5:112958281-112958303 CAGAATTTTGGGAAGGGATGCGG - Intergenic
995654008 5:114403870-114403892 CAGAAAATAGAGTAGTCGTGGGG + Intronic
995771138 5:115671690-115671712 AAGAGTAGTGAAAAGTGGTGGGG + Intergenic
995959041 5:117816947-117816969 AAGAATAATGAAAAGAGGTGAGG - Intergenic
997928957 5:138056651-138056673 CAAAATATTGTGGGGTGGTGGGG + Intergenic
998136480 5:139676914-139676936 CAGAATAGAGACAGGTGGTGGGG - Intronic
998672720 5:144371945-144371967 AAAAAAATTGAGAAGGGGTGTGG - Intronic
1000484351 5:161821543-161821565 CAGAAAATGGAGAGCTGGTGGGG - Intergenic
1001625712 5:173131135-173131157 CAAAATATTAACAACTGGTGAGG - Intronic
1002444622 5:179281800-179281822 AAGAATAATGAGTATTGGTGGGG - Intronic
1004062678 6:12213433-12213455 CAGAAGATTCAGAAGTGCTATGG - Intergenic
1004520480 6:16356996-16357018 AAGAATATAAAGAGGTGGTGTGG - Intronic
1004746608 6:18515137-18515159 AAAAATTTTTAGAAGTGGTGAGG + Intergenic
1006979398 6:38134784-38134806 CAGCAAAATGTGAAGTGGTGAGG - Intronic
1008465508 6:51825765-51825787 CAGAATGGTGACAAGTGGAGTGG - Intronic
1009226464 6:61024444-61024466 CATAATATCCAGAAGTGGAGAGG + Intergenic
1011180966 6:84620198-84620220 CAGAAGCTGGAGAAGTGATGGGG - Intergenic
1012352451 6:98269347-98269369 CAGAATATTCACAAGTTCTGGGG - Intergenic
1014727720 6:124992566-124992588 TAGAATAGTGAGAAGAGGGGAGG + Intronic
1014897942 6:126926759-126926781 CAGGAAATTGAGAAGCGGTCGGG - Intergenic
1015169735 6:130239248-130239270 CGGCATATTGTGAAATGGTGTGG + Intronic
1015313202 6:131787729-131787751 CTATATATTGAGAAGTTGTGGGG + Intergenic
1015339419 6:132080706-132080728 CAGAAGATTGAGAAAGGGTTGGG - Intergenic
1015508996 6:134018889-134018911 GAGAAGATAGAGAAGTGGTAGGG - Intronic
1015743731 6:136487114-136487136 CATGACATTGACAAGTGGTGGGG + Intronic
1016221393 6:141674802-141674824 GATAATATTTAGAGGTGGTGAGG - Intergenic
1018454416 6:163939507-163939529 GCAAATATAGAGAAGTGGTGTGG + Intergenic
1020370119 7:7422703-7422725 CAGAATATTGATAGGTAGGGTGG - Intronic
1020671425 7:11119414-11119436 TATAAAATTCAGAAGTGGTGTGG + Intronic
1023607665 7:41944685-41944707 AGGAATGTGGAGAAGTGGTGAGG + Intergenic
1024403792 7:48954055-48954077 TAGAATATGGAAGAGTGGTGTGG + Intergenic
1024907369 7:54401555-54401577 GAGAAAACTGAGAAGTGGAGAGG + Intergenic
1025101128 7:56136110-56136132 CAGGATATTTTGAAGTGGAGAGG + Intergenic
1026317795 7:69242144-69242166 CAGGATATTTTGAAGTGGAGAGG - Intergenic
1026318218 7:69245955-69245977 CAGGATATTTTGAAGTGGAGAGG - Intergenic
1028780590 7:94731020-94731042 AAGAATAGTGAGGAGTGGGGTGG + Intergenic
1028893692 7:96016899-96016921 CTGAATTTAGAGAAGTCGTGTGG + Intronic
1029918483 7:104237075-104237097 CAAAATAATGAGAAGTGATAAGG + Intergenic
1030106147 7:105989220-105989242 CAGAAAGTGGAGAAGAGGTGGGG - Intronic
1031581897 7:123486370-123486392 CAGGGTATTGAGAAGTTGTTAGG - Intronic
1032896042 7:136251872-136251894 GGGAACATTGAGCAGTGGTGTGG + Intergenic
1033655520 7:143371193-143371215 TAGTCTAGTGAGAAGTGGTGGGG + Intergenic
1037928462 8:22863609-22863631 CAGAGCAGTGAGAAGGGGTGGGG - Intronic
1043305715 8:78791771-78791793 CAGACTGTAGAGAAGTGGTGGGG - Intronic
1044460604 8:92439964-92439986 CAGAAGAGTGAGGAGTGGAGGGG + Intergenic
1044815633 8:96109412-96109434 CAGAATATTCAGAGGAGGAGGGG - Intergenic
1047101756 8:121684253-121684275 AAGAAATTTAAGAAGTGGTGGGG - Intergenic
1047632112 8:126719412-126719434 TAGTAGATTGAGAAGTGGTATGG - Intergenic
1048077282 8:131085516-131085538 CAGAATTTTGTGAAATGATGAGG + Intergenic
1050797845 9:9567446-9567468 AAGAATTTTGAGAAGAGATGTGG + Intronic
1053189327 9:36048773-36048795 CAGAATATAGAGAAATGAGGTGG - Intronic
1055018423 9:71644077-71644099 CTGAATAATGAAAAGTGGTGGGG + Intergenic
1056368410 9:85929503-85929525 AAGAAGGTTGGGAAGTGGTGGGG - Intergenic
1060131646 9:121106033-121106055 CAGAATATTCAAAAGTGGAGTGG + Intronic
1060763434 9:126275303-126275325 CAGAATAAAGAGAAGAGGAGAGG - Intergenic
1186303340 X:8226037-8226059 CAGAAAATTAAAAAGTTGTGTGG - Intergenic
1189197808 X:39166631-39166653 CATAAAATTGAGAAAAGGTGAGG + Intergenic
1189375465 X:40463075-40463097 CAGAATACAAAGAAGTGGAGGGG + Intergenic
1195318966 X:103705834-103705856 CAGAATAGAGAGAGTTGGTGTGG - Intergenic
1195706201 X:107739602-107739624 CAGAGTCTGGAGAAGTTGTGTGG + Intronic
1196041176 X:111206020-111206042 CAGTATTTTGAGAAGTTTTGTGG + Intronic
1197941680 X:131796159-131796181 CGGAATACTGAGATCTGGTGGGG - Intergenic
1199053114 X:143260878-143260900 AAGAATAATGAGAAGAGGCGGGG + Intergenic
1199686407 X:150269275-150269297 AAGACTATTGGGAAGTGCTGGGG + Intergenic