ID: 1102210102

View in Genome Browser
Species Human (GRCh38)
Location 12:111120406-111120428
Sequence CCGGCTATTTGTGGTTTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102210102_1102210108 -4 Left 1102210102 12:111120406-111120428 CCCTTAAAACCACAAATAGCCGG 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1102210108 12:111120425-111120447 CCGGGCTTCAGCATCTGCCGTGG 0: 1
1: 0
2: 1
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102210102 Original CRISPR CCGGCTATTTGTGGTTTTAA GGG (reversed) Intronic
900111650 1:1008987-1009009 CCGGCTATTTTTTTTTTTAGAGG + Intergenic
907922739 1:58928704-58928726 CCAGCTATTTGAGATTTCAAAGG - Intergenic
918583220 1:186157001-186157023 CTGGGTATCTGTGTTTTTAATGG - Intronic
919191140 1:194220701-194220723 CAGACTATGTGTGTTTTTAAGGG - Intergenic
919420250 1:197361452-197361474 TCGGCAATTTGTGGATTTCAAGG + Intronic
919644217 1:200077414-200077436 CAACCTAATTGTGGTTTTAATGG - Intronic
920266106 1:204724293-204724315 CTGGAAATTTGAGGTTTTAAGGG + Intergenic
921396009 1:214670322-214670344 CCAGCTGTTTGTTGTTTTAACGG + Intergenic
923602582 1:235416299-235416321 CAGGCTATTTGTATTTTAAATGG - Intronic
1067697869 10:48548627-48548649 CCCGCTCCTTGTGGATTTAAAGG + Intronic
1072854179 10:98929160-98929182 CCTGCTATTTGTGCTTACAAGGG - Intronic
1075887365 10:125912797-125912819 CCAGCTAATTGTGTTTTTAGTGG + Intronic
1089400517 11:118161662-118161684 CTTGATATTTGTGGTTCTAATGG - Intergenic
1092193135 12:6534368-6534390 CCGGCTACTAGCGGTTTTACGGG + Exonic
1093598349 12:20989591-20989613 AATGCTTTTTGTGGTTTTAAAGG + Intergenic
1095328254 12:40924287-40924309 CAGGATATTTGTGATTTTCAGGG + Intronic
1095388837 12:41681079-41681101 CTTGCTATTTGGTGTTTTAAAGG + Intergenic
1095574561 12:43721205-43721227 CTGGCCCTTTTTGGTTTTAAGGG - Intergenic
1097238667 12:57558107-57558129 CAGGCTGTTTTTGTTTTTAAAGG - Intronic
1097721019 12:63021602-63021624 CCAGCTGTTTGTGGTTCTCACGG - Intergenic
1098207664 12:68130064-68130086 CCGCCTATATGTGTTTTTAGAGG + Intergenic
1099416931 12:82400464-82400486 CCAGATATTTTTGGATTTAAGGG + Intronic
1101868991 12:108546682-108546704 CCGGCTAATTGTATTTTTAGTGG + Intronic
1101980424 12:109401531-109401553 CCAGGCATTTGTGTTTTTAAAGG - Intronic
1102210102 12:111120406-111120428 CCGGCTATTTGTGGTTTTAAGGG - Intronic
1103178915 12:118890478-118890500 TCATCTATTTGTGGTTTAAACGG - Intergenic
1107137807 13:36963453-36963475 CAGGTTCTTTGTGGTTTGAAAGG - Intronic
1111624541 13:90767660-90767682 GGGTATATTTGTGGTTTTAATGG - Intergenic
1112546636 13:100377395-100377417 CAGACTATTTGTGTCTTTAAGGG + Intronic
1114140798 14:19908265-19908287 CCTGATATTTGTGGTTTCAAAGG - Intergenic
1116512966 14:45769392-45769414 TAGACTATTTGTGGGTTTAAGGG + Intergenic
1116614452 14:47116430-47116452 TTGGCTATTTGTGGTTTTTGTGG - Intronic
1202870758 14_GL000225v1_random:161207-161229 CCAGCTAATTGTGTTTTTAGTGG - Intergenic
1123772054 15:23538814-23538836 CCAGTCATTTGTTGTTTTAATGG - Intergenic
1124456897 15:29851393-29851415 TTGGCTATTTGTGGTTTTTGAGG - Intronic
1125143035 15:36432278-36432300 CAGCCTATTTGTGGGTGTAAGGG + Intergenic
1126746737 15:51833042-51833064 CCATATATTTGTGATTTTAAAGG - Intronic
1135111806 16:19696178-19696200 CCGGCTATCCTTTGTTTTAATGG + Intronic
1140213845 16:72991944-72991966 GTGGGTATTTGTGGTTATAACGG + Intronic
1140823772 16:78686598-78686620 CCAGCTATTTGTGTTTTTGGAGG + Intronic
1146759737 17:35466849-35466871 CTAGTCATTTGTGGTTTTAATGG - Intronic
1150397792 17:64835041-64835063 CCGGCTGATTGCAGTTTTAAAGG - Intergenic
1153992111 18:10409866-10409888 TCAGCTGTTTGTGGTTATAAGGG + Intergenic
1155859099 18:30874114-30874136 CCGGCTAATTGTATTTTTATTGG - Intergenic
1157365856 18:47063770-47063792 CCTGCTAATTGTGTTTTTCATGG - Intronic
1160252976 18:77220313-77220335 GTGGCTATTTGTGGATTTAAGGG + Intergenic
1160925170 19:1540878-1540900 CCGGCTCATTTTGTTTTTAAAGG - Intergenic
1163208432 19:15821603-15821625 CCGGCTATTTTTTGTATTTATGG - Intergenic
1167111935 19:47467694-47467716 CCAGCGATTTGTGTTTTAAAAGG - Intronic
925600806 2:5607173-5607195 CCCGCTATTTCTGGTTTTAAGGG - Intergenic
926269592 2:11355180-11355202 CTGGCTAATTGTGTTTTTAGTGG - Intergenic
928358359 2:30641568-30641590 CAAGCCATTTGTTGTTTTAATGG - Exonic
929178222 2:39003597-39003619 CTGGGTATTTTTGGTTTGAATGG - Intronic
937351598 2:121167739-121167761 CCTGATATTTCTGGTTTTGAAGG - Intergenic
938061561 2:128259176-128259198 CCAGCTATTTATGTTTTGAATGG + Intronic
938664910 2:133524834-133524856 ACAGCTATTTGTGGTATAAATGG + Intronic
940706507 2:157111220-157111242 CCATATATTTGTAGTTTTAAGGG - Intergenic
942914311 2:181284616-181284638 CCGGCCATTCCTGTTTTTAAGGG + Intergenic
945951790 2:216045875-216045897 CCGGTTTTTTGTGTTTTTGAGGG - Intronic
948713692 2:239843714-239843736 CAGGCTTTTGGTGGTTTTTAGGG + Intergenic
1168937644 20:1680303-1680325 CCAGTCATTTGTTGTTTTAATGG - Intergenic
1168940023 20:1701605-1701627 CCAGGCATTTGTTGTTTTAATGG - Intergenic
1173525746 20:43731265-43731287 CCGGCTGTTTGTGCTTCTAATGG + Intergenic
1173725666 20:45295684-45295706 GCTGCAATTTGTGTTTTTAAAGG + Intronic
1178679623 21:34662137-34662159 CAGTCTATTTGTGTTTTTACAGG - Intergenic
1178822233 21:35985766-35985788 CCGGCTAATTTTGTTTTTAGTGG - Intronic
1178881433 21:36453259-36453281 CTGGCTCATTGTAGTTTTAATGG + Intergenic
1179004223 21:37495625-37495647 CCGGCTATTTGTTTTTTAGATGG - Intronic
952151107 3:30593161-30593183 CAGCTTATTTGTGGGTTTAATGG + Intergenic
954330206 3:49885770-49885792 CCAGCTATTTGTACTTGTAAAGG - Intergenic
957204377 3:77176050-77176072 CCTGCTATTTGCTGATTTAATGG - Intronic
957299150 3:78368342-78368364 CCAGCTAATTTTTGTTTTAATGG - Intergenic
960335544 3:116413162-116413184 CAAGAAATTTGTGGTTTTAATGG - Intronic
960824786 3:121771266-121771288 CCGGCCATTTCTGTGTTTAAAGG + Intronic
965148604 3:164940570-164940592 CAGGATATTTTTGGTTTAAAAGG - Intergenic
966360603 3:179125375-179125397 CAGGCTATATGTGTTTTTACAGG - Intergenic
966407803 3:179616882-179616904 CCAACTTCTTGTGGTTTTAAAGG - Intronic
969854108 4:9985341-9985363 AAGGTTATTTGTGGTTTTCATGG - Intronic
973821604 4:54666572-54666594 CCGGCAATTTTTTTTTTTAAGGG + Intronic
974184327 4:58427052-58427074 TCGTCTATTTCTGGTTTTCAAGG + Intergenic
974630720 4:64484237-64484259 CCGGCTAATTGTATTTTTAGTGG - Intergenic
974933145 4:68383116-68383138 CTGGCAATTTCTGGGTTTAAGGG - Intergenic
975555070 4:75654659-75654681 CCTGTTGTTTGTGGTTTAAATGG - Intronic
977985498 4:103377950-103377972 CCGGCAATTTCTTTTTTTAAAGG + Intergenic
978936103 4:114377836-114377858 ATGTCTCTTTGTGGTTTTAATGG + Intergenic
982789332 4:159572871-159572893 CTGGCCATTAGAGGTTTTAAGGG + Intergenic
986586955 5:9328612-9328634 CCGGCTAATTGTATTTTTAGTGG - Intronic
987018433 5:13845018-13845040 CCAGCTTTGTGTGGTTATAAAGG - Intronic
990593186 5:57286523-57286545 CAGGCTATTTGTGTCTTTATAGG - Intergenic
992919335 5:81497192-81497214 CCAATTATTTGTGTTTTTAAGGG + Intronic
995669692 5:114588376-114588398 CCTACTACTTGTGTTTTTAAAGG - Intergenic
998720848 5:144946875-144946897 CCAGCCATTTGTGTTTTAAAAGG + Intergenic
1001288514 5:170440348-170440370 CTGTGTATTTGTGGTTTAAATGG - Intronic
1002288254 5:178180059-178180081 CCCGTTTTTTGGGGTTTTAATGG + Intergenic
1004560084 6:16741299-16741321 CTGGATAACTGTGGTTTTAAAGG + Intronic
1008383873 6:50864943-50864965 CTAGCTACTTGTGGCTTTAAGGG + Intergenic
1009477061 6:64106147-64106169 TATGCCATTTGTGGTTTTAATGG + Intronic
1009847118 6:69148008-69148030 CAGTCTATTTGTGTTTTTATAGG + Intronic
1010638240 6:78286766-78286788 TTGGCTATTTGAGGTTTTTACGG + Intergenic
1010675980 6:78743902-78743924 CAAGCTATTTGTGTTTTTATAGG + Intergenic
1015876956 6:137832292-137832314 CGGACTACTTGTGGTTTGAAGGG + Intergenic
1021160617 7:17268736-17268758 CAGCCTATTTGTGTCTTTAAAGG + Intergenic
1022784101 7:33619118-33619140 CAGGCTATGTGTATTTTTAAAGG - Intergenic
1025242131 7:57285862-57285884 CCGGCCATTTCAGGTTTTCATGG + Intergenic
1027365225 7:77450408-77450430 CTGGCTATTGGTGCTTTGAATGG - Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1030831250 7:114224814-114224836 CTGGCTATTCCTGATTTTAAAGG + Intronic
1035950181 8:4011273-4011295 ACGACTATTTGTGTTTTTAGTGG + Intronic
1035967981 8:4215995-4216017 CTGGCTATTTGTGGCTGAAATGG - Intronic
1036556480 8:9864469-9864491 CCGGCTTTTTGGGGTTTTTAAGG - Intergenic
1038455193 8:27668242-27668264 CCGGCTATCTGTGATTTCTAAGG - Intronic
1038547833 8:28439584-28439606 CTGGCTAATTGTGGTTTTTGGGG - Intronic
1044882089 8:96734016-96734038 CCTGTCATATGTGGTTTTAAAGG + Intronic
1045043403 8:98249199-98249221 TCTGCAATTTGGGGTTTTAAAGG - Intronic
1051858348 9:21595784-21595806 CTGGCTATGTGTTTTTTTAAAGG + Intergenic
1053140456 9:35679558-35679580 CCGGCTATTTTTGGTTTTGTTGG - Intronic
1057534412 9:95885430-95885452 CCTACTATTTTTGGTTTTAGTGG + Intronic
1059191478 9:112331759-112331781 CACGCTATTTGTGGTTTTAAAGG - Intronic
1203733699 Un_GL000216v2:115384-115406 CCAGCTAATTGTGTTTTTAGTGG + Intergenic
1189447884 X:41098112-41098134 CAGGGTATTTGGGGTTTTACAGG - Intronic
1190946951 X:55104363-55104385 CAGGCTATGTGTGTTTTTATAGG - Intronic
1192757181 X:74058629-74058651 GCAGGTATTTGTTGTTTTAATGG - Intergenic
1193990859 X:88305287-88305309 CCAGCTATTTGTATTTTTAAGGG + Intergenic
1196430948 X:115624678-115624700 ACAGCTATTTGTGGCTTTTAAGG + Intronic
1202627315 Y:56873037-56873059 CCAGCTAATTGTGTTTTTAGTGG - Intergenic