ID: 1102210174 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:111120915-111120937 |
| Sequence | CCCCCGGGCTGGTTTCAGTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 177 | |||
| Summary | {0: 1, 1: 1, 2: 0, 3: 11, 4: 164} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1102210174_1102210182 | 3 | Left | 1102210174 | 12:111120915-111120937 | CCACACTGAAACCAGCCCGGGGG | 0: 1 1: 1 2: 0 3: 11 4: 164 |
||
| Right | 1102210182 | 12:111120941-111120963 | CCTGCTGTCTCAGAAGCTCAAGG | 0: 1 1: 0 2: 4 3: 60 4: 589 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1102210174 | Original CRISPR | CCCCCGGGCTGGTTTCAGTG TGG (reversed) | Intronic | ||