ID: 1102210174

View in Genome Browser
Species Human (GRCh38)
Location 12:111120915-111120937
Sequence CCCCCGGGCTGGTTTCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102210174_1102210182 3 Left 1102210174 12:111120915-111120937 CCACACTGAAACCAGCCCGGGGG 0: 1
1: 1
2: 0
3: 11
4: 164
Right 1102210182 12:111120941-111120963 CCTGCTGTCTCAGAAGCTCAAGG 0: 1
1: 0
2: 4
3: 60
4: 589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102210174 Original CRISPR CCCCCGGGCTGGTTTCAGTG TGG (reversed) Intronic