ID: 1102212735

View in Genome Browser
Species Human (GRCh38)
Location 12:111138862-111138884
Sequence TTCACCCCACACAGCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 229}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102212725_1102212735 19 Left 1102212725 12:111138820-111138842 CCTGGCCCGCTTCCCTCAAGTTG 0: 1
1: 0
2: 3
3: 13
4: 118
Right 1102212735 12:111138862-111138884 TTCACCCCACACAGCTCCCAGGG 0: 1
1: 1
2: 2
3: 24
4: 229
1102212731_1102212735 6 Left 1102212731 12:111138833-111138855 CCTCAAGTTGGGACTGCACTATG 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1102212735 12:111138862-111138884 TTCACCCCACACAGCTCCCAGGG 0: 1
1: 1
2: 2
3: 24
4: 229
1102212728_1102212735 14 Left 1102212728 12:111138825-111138847 CCCGCTTCCCTCAAGTTGGGACT 0: 1
1: 0
2: 0
3: 18
4: 146
Right 1102212735 12:111138862-111138884 TTCACCCCACACAGCTCCCAGGG 0: 1
1: 1
2: 2
3: 24
4: 229
1102212730_1102212735 7 Left 1102212730 12:111138832-111138854 CCCTCAAGTTGGGACTGCACTAT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1102212735 12:111138862-111138884 TTCACCCCACACAGCTCCCAGGG 0: 1
1: 1
2: 2
3: 24
4: 229
1102212729_1102212735 13 Left 1102212729 12:111138826-111138848 CCGCTTCCCTCAAGTTGGGACTG 0: 1
1: 0
2: 2
3: 17
4: 235
Right 1102212735 12:111138862-111138884 TTCACCCCACACAGCTCCCAGGG 0: 1
1: 1
2: 2
3: 24
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102212735 Original CRISPR TTCACCCCACACAGCTCCCA GGG Intronic