ID: 1102215053

View in Genome Browser
Species Human (GRCh38)
Location 12:111154958-111154980
Sequence GCTGCTGTGGTAGGTGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102215049_1102215053 -8 Left 1102215049 12:111154943-111154965 CCTGGCTCTGTCACTGCTGCTGT 0: 1
1: 1
2: 11
3: 65
4: 603
Right 1102215053 12:111154958-111154980 GCTGCTGTGGTAGGTGCTATGGG 0: 1
1: 0
2: 0
3: 20
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102215053 Original CRISPR GCTGCTGTGGTAGGTGCTAT GGG Intronic
901060970 1:6471748-6471770 GCTGCTGTGTGAGGTGCGCTGGG - Exonic
902122265 1:14176417-14176439 GCAGCTGTGGCAGCTGATATTGG - Intergenic
902595641 1:17507872-17507894 GCTCCTGAGGTGGGTGCCATTGG - Intergenic
903031992 1:20470374-20470396 GCTGCTGTGTGAGCTGATATGGG - Intergenic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
904451094 1:30612107-30612129 GCTGCTGTCCAAGGTGCTGTAGG - Intergenic
907360797 1:53912956-53912978 GCTGCTATAGTAGGTGTTGTTGG + Intergenic
907976558 1:59436471-59436493 GCTGTTGTTGTAGGGGCCATGGG - Intronic
909120032 1:71590922-71590944 GGTGCTGTGCTTGGTGATATGGG + Intronic
910061131 1:83094002-83094024 CCTGCTATGGTAGGCACTATAGG + Intergenic
912501748 1:110127203-110127225 TCTGCGGAGGTAGGTGCTCTGGG + Intergenic
913486409 1:119335740-119335762 GCTCCTGTGGTAGGAGTCATAGG + Intergenic
913488876 1:119359661-119359683 CATCTTGTGGTAGGTGCTATGGG - Intergenic
914444160 1:147735623-147735645 GTTGCTGTGGCAGCTGCTGTTGG + Intergenic
914938856 1:152004296-152004318 GCTGCTGGGCTGGGTGCTGTGGG + Intergenic
915942986 1:160130550-160130572 GCTGCTGTGCCAGATGCTGTGGG + Exonic
916515236 1:165510494-165510516 CCTTCTGTGGTAGGGGCTTTGGG - Intergenic
918131047 1:181630089-181630111 CCTGCTGTGGTAAGTGCTTATGG - Intronic
919415571 1:197304503-197304525 GCCTCTGTGGTAGATACTATGGG + Intronic
920191118 1:204194506-204194528 GGTGCTGTGCTAGGTGCTAGGGG + Intronic
920828529 1:209445227-209445249 GCTGCTGTGGTGGGTGCTGCTGG - Intergenic
920964068 1:210687818-210687840 GCTGCTGTGGCTGGTGCTGGTGG - Intronic
921595111 1:217046267-217046289 GATACTGTGCTAGGTGCTATAGG - Intronic
924028083 1:239858766-239858788 GCTGCTGGGGGAGGGGCTCTAGG - Intronic
924747576 1:246851141-246851163 GTTGCTGTGTTAGCTGCTTTAGG + Exonic
1062803441 10:396878-396900 GAGTCTGTGGTAGCTGCTATGGG - Intronic
1063555873 10:7079078-7079100 GCTGCTGTGTCAGGTGCTGCGGG - Intergenic
1067200574 10:44168388-44168410 GATGCTGTGCTTGGTTCTATGGG + Intergenic
1068385549 10:56322378-56322400 GCTGGTGTGGTAGGTACTAATGG - Intergenic
1069902231 10:71712936-71712958 GCTGCTCTGGAAGGTGCTGTGGG + Exonic
1070843900 10:79506747-79506769 CCTGCAGTGGTAGGTTCTCTGGG - Intergenic
1072681063 10:97507097-97507119 GCTGCTGAGGAAAGTGTTATGGG - Intronic
1072790420 10:98313740-98313762 GGTGCTGTGCCAGGTGCTTTGGG + Intergenic
1075117044 10:119635711-119635733 GCAACTGTGGCAGCTGCTATGGG + Intergenic
1076157634 10:128215917-128215939 GCTGCTGTGTTAGGTGGGATCGG + Intergenic
1076368091 10:129935222-129935244 GCTGCTGTGACAGGTGCGAGTGG - Intronic
1076669505 10:132111826-132111848 GCTGCTGTGGGAGGGGCTGAGGG + Intronic
1077395225 11:2317198-2317220 GCTGCTGTGGAATGTTCTAGGGG - Intronic
1077487524 11:2845910-2845932 GCCTCCGTGGTAGGTGCTGTGGG + Intronic
1078841305 11:15077540-15077562 TCTGCTCTGGTAGGTTCTTTAGG + Intronic
1079135886 11:17775805-17775827 ACTGCTGTTCTAGGTGCCATGGG - Intronic
1079153027 11:17918543-17918565 GGTGCTGTGCCAGGTGCTGTAGG + Intronic
1079158197 11:17968380-17968402 GGTGCTGTCCTAGGTGCTAGGGG + Intronic
1079307249 11:19334148-19334170 CATGCTGGGGTAGGGGCTATGGG + Intergenic
1079870978 11:25797567-25797589 GCTGCAGTGGTAGGGGCTGTGGG - Intergenic
1082234273 11:49803711-49803733 GTTGCCGTGGGAGGTGCTGTAGG + Intergenic
1083475579 11:62912913-62912935 GCTGCTGTGATAGGTGGCCTGGG + Intronic
1084453712 11:69255088-69255110 GCTGCTGTGGTGTATGGTATGGG + Intergenic
1084961904 11:72721287-72721309 GGTGCTGTGGTGGGTGCTTATGG - Intronic
1086662624 11:89440042-89440064 GCTGCTGTGGCAAGTGCTGTAGG - Intronic
1091499078 12:998252-998274 GCAGCTGTGCTAGTTTCTATTGG + Intronic
1091728555 12:2863136-2863158 GCGCCTGTGGTGGGTGCTACTGG + Intronic
1092010184 12:5103508-5103530 GCAGCTGTTCTAGGTGCTTTGGG - Intergenic
1092113432 12:5981099-5981121 GGCACTGTGCTAGGTGCTATGGG - Intronic
1092543425 12:9434051-9434073 GGTGCTGTGCTGGGGGCTATGGG - Intergenic
1093087876 12:14886686-14886708 GGTACTGTGCTAGGTGCTGTGGG + Intronic
1097235751 12:57538314-57538336 ACTGCTGGAGTAGGTGCTACTGG - Intronic
1102215053 12:111154958-111154980 GCTGCTGTGGTAGGTGCTATGGG + Intronic
1105051112 12:133051938-133051960 GTTACTGTGCTAGGTACTATGGG + Intronic
1105480796 13:20773707-20773729 GTTGCTGTGTTAGGCGCTGTTGG - Intronic
1106211123 13:27647176-27647198 GATACTGTGCAAGGTGCTATGGG - Intronic
1109618630 13:64871519-64871541 GCTGCTATGGTAGTTGTTTTAGG - Intergenic
1112792262 13:103015965-103015987 GCTGCAGTAGTAGATGCAATAGG + Intergenic
1113445389 13:110362378-110362400 GCTGCAGTGAAAGGTGCTAGGGG - Intronic
1117580135 14:57143614-57143636 GCTGCCATGGTAGGTGGTAGAGG - Intergenic
1117938211 14:60931484-60931506 GCTGCTGTGGCAAGTGGTAGTGG - Intronic
1118685316 14:68285041-68285063 TCTGCTGTGGTAGGAGCTGGAGG - Intronic
1122277992 14:100605065-100605087 GAGGCTGTGGAAGCTGCTATGGG + Intergenic
1122304454 14:100753221-100753243 GCTGCTGTGGTCGGGGCAGTCGG - Intergenic
1125987013 15:44063665-44063687 GATGCTGTGGAACTTGCTATGGG - Intronic
1126812700 15:52423639-52423661 ACTGCTGTGGCAGATGTTATGGG + Intronic
1126884064 15:53130832-53130854 GCTGATGTAGAAGGTGCTATAGG - Intergenic
1127625863 15:60779503-60779525 GCTGCTGTGGAAGATGTAATAGG + Intronic
1134190674 16:12118825-12118847 GCTGCTGTGGGAGTTCCTCTGGG + Intronic
1134372799 16:13641149-13641171 ACAGCTGTGGGAGGTGCTACTGG + Intergenic
1138236351 16:55386451-55386473 CCTGCTGTGCTAGGTGCTCTGGG - Intergenic
1138436179 16:57001220-57001242 GCTGCTGTTGTTGGTTCTTTAGG - Intronic
1141670558 16:85489571-85489593 GCTTGTGGGGTGGGTGCTATGGG - Intergenic
1142411765 16:89920647-89920669 GCTGCTGTGGGAGTAGCTCTTGG - Exonic
1142591060 17:1006314-1006336 GCAGCCGTGGAAGGTGCTACGGG + Intronic
1145019063 17:19415921-19415943 GCTGCTGTGGGGGGTGCTGTGGG + Exonic
1147963920 17:44183158-44183180 CCTCCTGTGATAGGTACTATAGG - Intergenic
1148341508 17:46876161-46876183 CCTGCTGGGGTTGGTGCTCTGGG + Intronic
1148805228 17:50260617-50260639 GCTGCTGTGGAAGATGCCAGTGG + Intergenic
1152633002 17:81419168-81419190 GCTGCTGTGGCAGGGGCTAGAGG - Intronic
1152878352 17:82801089-82801111 GCTGTTGGGGCAGGTGCTGTGGG + Intronic
1156651942 18:39235477-39235499 GCAGCTGTGGAAGGTGCACTGGG + Intergenic
1159932735 18:74331411-74331433 GGTTCTATGCTAGGTGCTATGGG - Intronic
1164412837 19:28020239-28020261 ACTGTTGGGGGAGGTGCTATTGG + Intergenic
1164517329 19:28947663-28947685 ACTGTTGAGGGAGGTGCTATTGG + Intergenic
1166041274 19:40204494-40204516 GCTGCTGTGGGAGCTGCTGACGG + Exonic
1167049713 19:47070952-47070974 GCTGCTGTGGCAGCTGCTGGGGG - Intronic
925797529 2:7563116-7563138 GGCTCTGTGTTAGGTGCTATGGG - Intergenic
926301285 2:11605024-11605046 GCCTCTGTGGTAGGTACTAAAGG - Intronic
927150820 2:20194807-20194829 GCTGCTGTGGGAGGGGCTTGGGG - Intergenic
927342450 2:21997742-21997764 GCAGCAGTGGTAGCTGCTGTTGG + Intergenic
927866944 2:26595162-26595184 GCATCTATGGTAGGTGCTGTGGG - Exonic
928336586 2:30403813-30403835 ACTATTGTGCTAGGTGCTATTGG - Intergenic
928399740 2:30969264-30969286 GCTGCTGTGGTCCCTGCTATGGG + Intronic
929363267 2:41120728-41120750 GATGTTGTTGTAAGTGCTATGGG + Intergenic
929914882 2:46126683-46126705 GGTTCTGTGTTAGGTCCTATGGG - Intronic
931296984 2:60937032-60937054 ATGGCTGTGGGAGGTGCTATAGG - Intergenic
931609766 2:64086334-64086356 TCTGCTTTGGTATATGCTATAGG - Intergenic
934989586 2:98911901-98911923 GAGGCTGTGGTATGTGGTATGGG - Intronic
935206733 2:100902797-100902819 GCTTCTGTGACAGGTGCAATGGG + Intronic
935339318 2:102045790-102045812 TCTGCTTTGGTTGGTGCTGTGGG + Intergenic
937774893 2:125764763-125764785 GATGCTGTGCTAGATGCTGTGGG + Intergenic
941059288 2:160827392-160827414 GCTGCTGTGTCTGGTTCTATGGG - Intergenic
941118648 2:161502816-161502838 GTTGCTGTGTTAGCTGCTTTAGG + Intronic
944658268 2:201898564-201898586 GTTGCTGTGGCAGATTCTATTGG - Intergenic
945273803 2:207968257-207968279 CATGCTGTAGTAGGTGCTCTGGG - Intronic
948586571 2:239023728-239023750 GCTGCTGTGGCAGCAGCTGTTGG - Intergenic
1169061104 20:2660895-2660917 GCGGCTGAGGTAGGTGGTCTGGG - Exonic
1169171466 20:3469117-3469139 GATTCTGAGGTAGGTGCCATAGG + Intergenic
1170464832 20:16612971-16612993 GCTGCTGTGGCAGGAGCTGAAGG - Intergenic
1177049257 21:16211367-16211389 GCAACTGTGGAAGTTGCTATTGG - Intergenic
1179193579 21:39144021-39144043 GCTGCTGTTCTAGGTGCTTGAGG - Intergenic
1179295119 21:40054746-40054768 GCTGCTGTGCTAGCTGTCATTGG + Intronic
1180782854 22:18530318-18530340 GCTGCTCTGGACGGTGCTGTTGG + Exonic
1181118972 22:20652759-20652781 GGTGCTGGGGTGGCTGCTATGGG + Intergenic
1181126417 22:20704349-20704371 GCTGCTCTGGACGGTGCTGTTGG + Intergenic
1181139099 22:20790986-20791008 GCTGCTGGGGTGGGTGGTACAGG - Intronic
1181239752 22:21469680-21469702 GCTGCTCTGGACGGTGCTGTTGG + Intergenic
1183468865 22:37995032-37995054 ACTGCTTTGGCAGGTGCAATGGG + Intronic
1183771340 22:39928554-39928576 CCTACTGTGTTGGGTGCTATGGG + Intronic
1185305274 22:50112054-50112076 GGGGCTGTGGGAGGTGTTATGGG + Intronic
1185388048 22:50545510-50545532 GCTGCTGGAGGAGGAGCTATGGG + Intergenic
950321700 3:12060706-12060728 GCTGCAGTGGTAAGTGCCAGAGG - Intronic
952651882 3:35737269-35737291 GCTGCTGTGGTGGCTGCTGTTGG - Exonic
952946761 3:38483010-38483032 GCTGCTGTGGTTGGGGCTGGTGG + Intronic
953143264 3:40249050-40249072 TCTACTGTGATAGGAGCTATAGG - Intronic
955009805 3:55003020-55003042 GGTGCTGTACTAGGTGCTAGAGG + Intronic
955157299 3:56429274-56429296 GCTGTTGGGATAGGTGTTATGGG - Intronic
955531380 3:59876473-59876495 GCTGCTGTGGGAGTTGGGATGGG + Intronic
960388843 3:117052109-117052131 GGAACTGTGGTAAGTGCTATAGG + Intronic
961006498 3:123409277-123409299 GGGGCTGTGCTAGGTGCCATGGG + Intronic
961450515 3:127000322-127000344 GCTGCTGTGGGAGGGGCTTCTGG + Intronic
961556135 3:127697805-127697827 GCTGCTGTTGTTGGGGGTATGGG + Intronic
962343402 3:134603253-134603275 GCTGCTGTTGTTGTTGCTGTAGG - Intronic
964516002 3:157508388-157508410 GCTCCTGTACTAGGTCCTATGGG - Intronic
965460039 3:168951339-168951361 GGTGCTGTGCTTGGTGCTATGGG - Intergenic
967651897 3:191996054-191996076 ACTGCTTAGGTAGGTGGTATGGG + Intergenic
968022259 3:195403319-195403341 GCTGCTGTTATCGTTGCTATGGG - Intronic
969111938 4:4849706-4849728 GCGGCTGTGGGAGGTGCCTTGGG + Intergenic
969854769 4:9990365-9990387 GCTGCTGTGTTGGGTGCTAGGGG + Intronic
973817436 4:54631867-54631889 GCTGCTGTAGTGGATGCTATGGG - Intergenic
975722688 4:77263584-77263606 ATTGCTGTGGGAGGTTCTATTGG + Intronic
979430832 4:120628309-120628331 GCTACTGTGGTATGAGCTTTTGG - Intergenic
981383529 4:144100315-144100337 GCTGCTGGGGTAGGGGAGATGGG + Intergenic
990310019 5:54529006-54529028 GCTGCTGTTGGAGGTGATAGCGG + Intronic
993298127 5:86170198-86170220 GGTGCTGAGGTAGATGCTTTGGG + Intergenic
994289715 5:98014554-98014576 GCTGCTATTGTAGGTCCCATTGG + Intergenic
994667990 5:102730511-102730533 GTTGCTGTGGCAAGTGCAATAGG - Intergenic
996765925 5:127033829-127033851 GCTGCTGTGGTGGGTGCTCCTGG + Intergenic
997216440 5:132114991-132115013 GCCTCTGTCCTAGGTGCTATGGG - Intergenic
998179422 5:139926058-139926080 GTTGCTGTGTTAGGGGCAATGGG - Intronic
998224057 5:140312714-140312736 GCTGCTAAGGTAGGTGCCCTGGG - Intergenic
998566141 5:143217570-143217592 GGTGCTGTGTTAGGTACCATGGG - Intronic
998595023 5:143520482-143520504 GGTACTGTGCTAGGTGCTGTAGG + Intergenic
1000111903 5:158116149-158116171 AATGCTGTGGTGGGTGCTCTAGG - Intergenic
1000114347 5:158139215-158139237 GATGCTGTGGTAGGTGTGGTGGG + Intergenic
1002187139 5:177459628-177459650 GGTGCGGTGGCAGGTGATATAGG + Intronic
1003300285 6:4874483-4874505 GCTGCAGTGTTAGGTGCTGTTGG + Intronic
1004484899 6:16057270-16057292 GCCACTGTGGAAGGTGCTATAGG - Intergenic
1005863600 6:29921169-29921191 GCTTCTGTGGCAGTTGCTTTTGG - Intergenic
1006322609 6:33329085-33329107 GCTGCTGTGGTTACTACTATGGG - Intronic
1009853306 6:69226530-69226552 TCAGCTGTGATAGGTGCAATGGG + Intronic
1009990785 6:70840649-70840671 GCAGCTCTTGTAGGTACTATTGG - Intronic
1013043661 6:106461813-106461835 GTGGCTGTGGCAGGTGCAATGGG + Intergenic
1013280520 6:108632188-108632210 GATGCGGTGCTAGGCGCTATGGG + Intronic
1013722826 6:113051350-113051372 GATGCTGTCACAGGTGCTATGGG - Intergenic
1014481175 6:121938582-121938604 GCTTCTGTGGTTTGTGCTTTTGG + Intergenic
1015263383 6:131263861-131263883 GCTACTGTGGTGTGTGCTTTGGG + Intronic
1018276666 6:162139552-162139574 GATGCTGTGGAGAGTGCTATGGG - Intronic
1019849559 7:3540579-3540601 TCTGCTATGATATGTGCTATGGG + Intronic
1021838336 7:24702653-24702675 GCTGTTGTGGTAAGTCCTAGAGG + Intronic
1022388750 7:29925593-29925615 GGTGCTGTGGAACGTGCTTTGGG + Intronic
1022549185 7:31220924-31220946 GCTGCAGAGATAGGTGTTATGGG - Intergenic
1023854983 7:44177382-44177404 GATGCTGTAGGAGATGCTATGGG + Intronic
1024498962 7:50080877-50080899 GCCGCTGTGCTAGGTTTTATGGG - Intronic
1026806810 7:73434037-73434059 GCTGCTGTGGCAGCTGCTGGCGG + Exonic
1027612527 7:80378938-80378960 GCTTCTTTCTTAGGTGCTATTGG + Intronic
1028754287 7:94417730-94417752 CCTGGTGTGGTTGGTGCTGTGGG + Exonic
1029092433 7:98058507-98058529 GCTGCTGGGGTAGGGGCCAGGGG + Intergenic
1029415658 7:100441704-100441726 TCTGCTGAGCCAGGTGCTATAGG + Intergenic
1032475788 7:132210762-132210784 GCTGCTGGGGCAGGTGTTGTGGG + Intronic
1032583575 7:133126357-133126379 GCTGACATGGTAGTTGCTATTGG - Intergenic
1034744006 7:153505025-153505047 GCTGCTGTGCTATGTCCTGTTGG + Intergenic
1035411530 7:158647260-158647282 GAGGCTGTGCTAGGTGCTGTTGG + Intronic
1036219807 8:6911894-6911916 GCAACTGTGGTAAGTGCTGTGGG - Intergenic
1037274247 8:17160316-17160338 GCTCCTTAGGCAGGTGCTATGGG + Intronic
1038914817 8:32009404-32009426 GATGCTGTTTTAGGTGCTAGGGG + Intronic
1041051578 8:53939703-53939725 GCTGCTGTTGTAGCTGCTCGTGG + Exonic
1043564557 8:81533751-81533773 GCTGCAGTGGTGGGTGACATGGG + Intergenic
1045184422 8:99822561-99822583 GCTACTTTGTTAGGTGCTAGAGG - Intronic
1046183732 8:110686276-110686298 GCCACTGTGCTAGGTGCTGTGGG + Intergenic
1046457422 8:114484773-114484795 GATGGTGTGGTAAGTGATATTGG + Intergenic
1048528146 8:135223400-135223422 GCTTCTGTGGCAGATGCTGTGGG - Intergenic
1054938808 9:70717425-70717447 TCTGCTGTGATTGGTGTTATGGG + Intronic
1054940499 9:70735418-70735440 TCTGCTGTGATTGGTGTTATGGG + Intronic
1056136685 9:83636224-83636246 GCCACTGTTGTAGGTGCTTTTGG - Intronic
1057767561 9:97935400-97935422 GCTGGGGTGGAAGGTGCTGTTGG + Intronic
1058498229 9:105583163-105583185 GCTGCTATGGCAGGCACTATAGG - Intronic
1060010375 9:120038543-120038565 GCTGCAGTGGTGGGTGGTGTGGG - Intergenic
1060495152 9:124113023-124113045 GCTGCTGTGGCAGCTGCCCTGGG + Intergenic
1061046890 9:128170192-128170214 GATCCTGTGGGAGTTGCTATTGG - Intronic
1185702552 X:2242240-2242262 GATGCTGTGGTAGGGGCCAAGGG - Intronic
1187069244 X:15871778-15871800 GCTTGTGTGTTAGGTGCTTTGGG - Intergenic
1190744524 X:53314327-53314349 GGTTCTGTGTTAGGTGCTGTGGG - Intronic
1191857624 X:65639956-65639978 GGTGCTGTGCTAGATGCTAGGGG + Intronic
1192809230 X:74535079-74535101 GCTGCTGGGGAAGGGGCTAGGGG - Intergenic
1195326732 X:103764504-103764526 GCTGCTGTGGGATGGGATATTGG + Intergenic
1196395586 X:115258473-115258495 GCTGCTTTGGTAAGGCCTATGGG + Intergenic
1198126939 X:133654193-133654215 GCTATTGTGTTAGGTGCCATGGG + Intronic
1198708357 X:139474241-139474263 GCTTCTATGGCAGGTGCTAAAGG + Intergenic
1200519699 Y:4195661-4195683 GCAGCTGTGGAGGGTGCTCTGGG - Intergenic