ID: 1102219637

View in Genome Browser
Species Human (GRCh38)
Location 12:111185855-111185877
Sequence CCTGCAATGTAGGAGCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102219633_1102219637 -4 Left 1102219633 12:111185836-111185858 CCACGGTCCGAGGGGGCTGCCTG 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1102219637 12:111185855-111185877 CCTGCAATGTAGGAGCTGCTAGG 0: 1
1: 0
2: 0
3: 17
4: 164
1102219627_1102219637 12 Left 1102219627 12:111185820-111185842 CCTGCCTGTGTCAGCTCCACGGT 0: 1
1: 0
2: 1
3: 14
4: 161
Right 1102219637 12:111185855-111185877 CCTGCAATGTAGGAGCTGCTAGG 0: 1
1: 0
2: 0
3: 17
4: 164
1102219628_1102219637 8 Left 1102219628 12:111185824-111185846 CCTGTGTCAGCTCCACGGTCCGA 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1102219637 12:111185855-111185877 CCTGCAATGTAGGAGCTGCTAGG 0: 1
1: 0
2: 0
3: 17
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102219637 Original CRISPR CCTGCAATGTAGGAGCTGCT AGG Intronic
902264794 1:15255608-15255630 CCTGCAATCAGGAAGCTGCTAGG + Intronic
903041500 1:20534004-20534026 CATGCAATGTAAGAGCAGCTTGG - Intergenic
904373251 1:30064120-30064142 CATGGAATGTAGGAGCTGGCAGG - Intergenic
905631394 1:39521008-39521030 CCTGTGAAGTAGGAGCTGCAGGG + Intronic
905666360 1:39765163-39765185 CCTGTGAAGTAGGAGCTGCAGGG - Intronic
906847435 1:49208436-49208458 CCTGCAAGGTGGGAGAAGCTGGG - Intronic
914804640 1:150983173-150983195 CCAGCAAGGTAGGGGCTGTTGGG + Exonic
917211747 1:172638800-172638822 TCTTCAAGGAAGGAGCTGCTTGG + Intergenic
918126070 1:181585080-181585102 CCTGTAATATAGGTGATGCTTGG + Intronic
919796310 1:201323356-201323378 CCTGCCCTTTAGGAGCTGCTGGG + Intronic
919919501 1:202159889-202159911 CCAGCAGTGTTGGAGCTGGTTGG + Intronic
920812829 1:209303261-209303283 CCTGTAATGGGGGAGCTGTTCGG - Intergenic
922972733 1:229756805-229756827 CCTCTAATGTGGGTGCTGCTTGG - Intergenic
923278590 1:232419874-232419896 CCTGGAATATAGAAGATGCTCGG - Intronic
1064437305 10:15322468-15322490 CCTGAACTGTAGCAGCAGCTAGG + Intronic
1069910792 10:71757914-71757936 TCAGCAATGCAGGAGCTCCTTGG + Intronic
1070342001 10:75506525-75506547 CCTGCCCTGTAGGAGCTCATGGG + Intronic
1071506551 10:86235219-86235241 TCTGCAATGTGGGAGCCGCAGGG - Intronic
1071833781 10:89398464-89398486 TATGCAATGTAAGAGCAGCTAGG - Intronic
1072292477 10:93976955-93976977 CCTGGTATGTATGAGCTGCTTGG + Intergenic
1073431642 10:103491140-103491162 CCTGCCAGGGAGGAGTTGCTGGG + Intergenic
1073789930 10:106929584-106929606 CCTGCAATGTAGGCGTTTTTTGG - Intronic
1074503861 10:114049968-114049990 CCAGCAGTGTGGGAGCTTCTTGG - Intergenic
1074606073 10:114968632-114968654 TCTGCCTTGTTGGAGCTGCTAGG + Intronic
1074819764 10:117169007-117169029 CCTGCATTGTCAGACCTGCTGGG + Intergenic
1075398157 10:122142594-122142616 CCTGCAATCTGGGAGCTCCCTGG + Intronic
1077832549 11:5890332-5890354 CCTGCAATGAAGGAGCAGGTGGG + Intronic
1083793310 11:64999839-64999861 CCTGCCATGTAGGAGCTCATTGG - Intergenic
1085517171 11:77118377-77118399 CCTGCCCTGTAGCAGCTGCGGGG + Intronic
1086809116 11:91283016-91283038 CATGCAATGTACTAGATGCTGGG + Intergenic
1086833916 11:91598895-91598917 CCTGGAATGAAGGAGAGGCTGGG + Intergenic
1086848703 11:91783279-91783301 CATCCAATGCTGGAGCTGCTGGG + Intergenic
1089158856 11:116422818-116422840 AAAGCACTGTAGGAGCTGCTGGG - Intergenic
1091395947 12:154356-154378 CCTGCAATGGTGGGGGTGCTGGG - Intronic
1091679348 12:2515671-2515693 AGTGCAGTGCAGGAGCTGCTTGG + Intronic
1092050230 12:5464147-5464169 CCTGCAATATAGAATCTGTTGGG - Intronic
1094397105 12:30019554-30019576 ACTGCAATGCAGGGGCTGCGAGG + Intergenic
1099216654 12:79861724-79861746 CCTGCAATGTGGGAGCTTGGCGG + Intronic
1102219637 12:111185855-111185877 CCTGCAATGTAGGAGCTGCTAGG + Intronic
1104607125 12:130198342-130198364 CATGAGATGCAGGAGCTGCTGGG + Intergenic
1108193617 13:47969374-47969396 CCTGGAATGTAATAGGTGCTTGG - Intronic
1112576706 13:100642720-100642742 GCTGCCATGATGGAGCTGCTGGG + Intronic
1113360921 13:109630804-109630826 CCTTCAGGGAAGGAGCTGCTGGG - Intergenic
1113744301 13:112732141-112732163 CCCTGAATGGAGGAGCTGCTTGG - Intronic
1115245836 14:31294069-31294091 GATGGAATGTAGGAGCTGGTAGG + Exonic
1118339326 14:64880641-64880663 CCTACAATGTGCGAGCTCCTTGG - Intergenic
1122909725 14:104821536-104821558 CCTGCAACGCAGGAGCGGGTCGG + Intergenic
1124108455 15:26763423-26763445 CTTGCCATGTAGGATATGCTTGG - Intronic
1124982078 15:34575884-34575906 GCTGGAATATAGTAGCTGCTTGG + Intronic
1125503587 15:40253791-40253813 TCTGGAGTGTAGGTGCTGCTGGG + Intronic
1129689048 15:77702908-77702930 CCTGCCCTCCAGGAGCTGCTGGG - Intronic
1137530738 16:49277280-49277302 CCTGCAACGGCAGAGCTGCTGGG + Intergenic
1139752282 16:69116375-69116397 GCTACAATCTTGGAGCTGCTTGG + Exonic
1143689937 17:8552870-8552892 TCTGAAATGCAGGAGCTGCTGGG - Intronic
1143837030 17:9700905-9700927 CCTGCCCTGTAGGAGCTGGTGGG + Intronic
1143837217 17:9701876-9701898 CCTGCCCTGTAGGAGCTGGTGGG + Intronic
1145325296 17:21817554-21817576 CCTGTAATCTTGGAGCTACTTGG - Intergenic
1146676868 17:34779774-34779796 CCTGCAATGCACTAGGTGCTGGG + Intergenic
1147122468 17:38343740-38343762 CCTCCTATGTGGGGGCTGCTGGG - Exonic
1147499545 17:40949492-40949514 CGTGCAGTGTAAGAGCAGCTAGG + Intergenic
1148331240 17:46815116-46815138 GCTGGAATGTAGCAGGTGCTGGG + Intronic
1149171716 17:53820082-53820104 CAGGCAATGTTGGTGCTGCTGGG - Intergenic
1149439722 17:56664086-56664108 CCTGCAGAGGAGCAGCTGCTTGG - Intergenic
1150376740 17:64687743-64687765 CCTGGTATGGAGGAGCTTCTGGG - Intergenic
1151732127 17:75917832-75917854 CCAGCACTGCAGGAGCGGCTGGG - Exonic
1152157770 17:78646140-78646162 CCTGCAACTGAGGAGCAGCTGGG - Intergenic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1152642118 17:81453670-81453692 CCAGCACTGTGGGAACTGCTGGG + Intronic
1153627770 18:7038247-7038269 CAGGCAAGGGAGGAGCTGCTCGG - Intronic
1156047708 18:32896289-32896311 CCTACAATGTTGGAGGTGTTTGG + Intergenic
1156807193 18:41198938-41198960 TCTGCATAGTAGAAGCTGCTGGG - Intergenic
1157502179 18:48199053-48199075 CCTGGAATCTAGAAGCTACTGGG - Intronic
1157513378 18:48294510-48294532 CCAGCATTGTAGGAGCGGCAGGG - Intronic
1160521249 18:79509385-79509407 CCTTCACTGTAGGAGGAGCTGGG + Intronic
1160529447 18:79555028-79555050 CCTGCAAGGCAGCCGCTGCTGGG + Intergenic
1160717852 19:584502-584524 CCTGCTAGGTGGGGGCTGCTGGG + Intergenic
1161136769 19:2624700-2624722 CCTGCAGGTCAGGAGCTGCTAGG - Intronic
1161520313 19:4720109-4720131 CCTGAAATGCAGGAGGTTCTGGG + Intronic
1166342085 19:42144276-42144298 CCTGCAACCCAGGAGGTGCTTGG + Intronic
1166756637 19:45196488-45196510 CCTGCCAAGGAGGAGGTGCTAGG + Intronic
926546281 2:14244800-14244822 CCTGCAATGTAGCAAGTGGTGGG - Intergenic
926756855 2:16243472-16243494 CCTTGAATCAAGGAGCTGCTTGG + Intergenic
927886751 2:26723508-26723530 GCTCCCAAGTAGGAGCTGCTGGG + Intronic
928289249 2:30023271-30023293 GCTGGAGTGTATGAGCTGCTGGG + Intergenic
928500827 2:31893286-31893308 TCTGCAATGCAGGGGCTTCTTGG + Intronic
929217884 2:39435738-39435760 CCTACAATGTATGAGATACTTGG - Intronic
929252800 2:39778384-39778406 CCCACACTGTAGGAGCTGCCAGG + Intronic
932587897 2:73043621-73043643 TTTGGAATCTAGGAGCTGCTAGG - Intronic
935016454 2:99187192-99187214 TCTGCAATGCAGGAAATGCTGGG + Intronic
935800624 2:106691593-106691615 CCTGCCATGGAGGAGCTCGTTGG - Intergenic
937211686 2:120276802-120276824 CCTGCAAGGTAGGTGGTGGTTGG + Intronic
938187003 2:129240603-129240625 CCTGCAGTGGGGGAGCTTCTGGG - Intergenic
942391902 2:175503412-175503434 CATGCCATGTAGCTGCTGCTGGG + Intergenic
946450216 2:219773298-219773320 CCTGAAATGAAGGAGCTGGGAGG + Intergenic
948580552 2:238985125-238985147 TCTGCAATGTGGCAGCTGCTTGG + Intergenic
1169331758 20:4721868-4721890 CCAGCTATATAGGAGCTGCCGGG - Intergenic
1170277357 20:14606523-14606545 CCTGAAAAGCAGGAGTTGCTGGG + Intronic
1170573675 20:17647179-17647201 CCAGCAATTTACGAACTGCTGGG - Intronic
1174829685 20:53801262-53801284 CCTGGAGTGGAAGAGCTGCTGGG - Intergenic
1175296773 20:57913933-57913955 TCTGCCAGGTGGGAGCTGCTGGG - Intergenic
1175933815 20:62505971-62505993 CCCGCAATGTTGGAGCCGCTGGG + Intergenic
1176378152 21:6096930-6096952 CCTGCGAGGTAGGAGCTCCCAGG - Intergenic
1178617234 21:34144886-34144908 TGTACAGTGTAGGAGCTGCTGGG + Intergenic
1179745321 21:43441316-43441338 CCTGCGAGGTAGGAGCTCCCAGG + Intergenic
1180847740 22:18993482-18993504 CCTGGAATGTAAGAGGCGCTTGG + Intergenic
1181115088 22:20627376-20627398 CCTGCCCTGTAGGAGATGCTTGG - Intergenic
1181601420 22:23954004-23954026 CCTGCAGAGTAGCTGCTGCTGGG + Intergenic
1181607087 22:23987333-23987355 CCTGCAGAGTAGCTGCTGCTGGG - Intergenic
1182681196 22:32081290-32081312 CCTGCTATGTAAGAGGTGCTTGG + Intronic
1184732701 22:46379580-46379602 CCTGGAATGTAGTAGGCGCTTGG - Intronic
949503152 3:4701350-4701372 CCTGGCATGTAGGAAGTGCTGGG + Intronic
953703624 3:45215186-45215208 CCTGCCATGCATGAGCTGTTTGG - Intergenic
954269124 3:49493711-49493733 CCAGCAATGTGGGAGCTAGTGGG + Intronic
954395991 3:50293589-50293611 CCTGCCATGTAGCACATGCTGGG - Intronic
955195882 3:56804389-56804411 CCTGAGAAGTAGGAACTGCTGGG - Intronic
956424488 3:69119051-69119073 CCTGGGATGTGGGAGCTGTTGGG - Exonic
960899266 3:122538256-122538278 CCTGACATGTAGGAGGAGCTTGG - Intronic
966650819 3:182298882-182298904 CCTGCATTGTACGAGCTGATTGG - Intergenic
967279613 3:187809076-187809098 CCTGCACTGTAAGAGCAGCCTGG - Intergenic
968990979 4:3912278-3912300 CCCCCAAAGTAGGAGCAGCTGGG - Intergenic
969506760 4:7592924-7592946 CATGCTATGGAGGTGCTGCTTGG + Intronic
970426892 4:15954018-15954040 CATGCAGTGTAAGAGCAGCTAGG - Intergenic
970980966 4:22096447-22096469 CCTGCAATGTGGATGCAGCTGGG - Intergenic
971168726 4:24211406-24211428 GCAGCAATGAAGGAGCTGCCAGG + Intergenic
972149950 4:36077071-36077093 CCTGCAATCTAGGAGCTTGCAGG + Intronic
973547741 4:51998924-51998946 CCTGCTATGTACTAGGTGCTAGG - Intronic
977556970 4:98496602-98496624 CCTGCAATCAAGTAGCTGCTGGG + Intronic
978190004 4:105899590-105899612 ACTGCTATGTGCGAGCTGCTTGG - Intronic
983059633 4:163143311-163143333 GCTATAATGTAGGATCTGCTGGG + Intronic
987190652 5:15474050-15474072 CCAGCAATGTATGATATGCTTGG + Intergenic
987506596 5:18782423-18782445 TATGCAATGTAAGAGCAGCTAGG + Intergenic
987701804 5:21409551-21409573 TATGCAATGTAAGAGCAGCTAGG + Intergenic
993256971 5:85604424-85604446 CCTGCCATGTAGCTGCTGCAGGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997255201 5:132423116-132423138 CCTCCAAAGTGGGAGCTGCAGGG + Intronic
1000743597 5:165001517-165001539 CCTGCCATCCAGGAGCTGATGGG - Intergenic
1001815902 5:174669280-174669302 TCTGCAACTTAGGAGCTGCTAGG + Intergenic
1003420994 6:5958596-5958618 CCTGCAATGTGCGAGCAGTTTGG - Intergenic
1005304000 6:24496198-24496220 CCTGCACTGTTGGAGGTGCTTGG + Intronic
1007315797 6:40987780-40987802 TCTACAATGTAGAAGGTGCTTGG - Intergenic
1007729047 6:43934751-43934773 CCTGGGATGGAGCAGCTGCTTGG - Intergenic
1009627125 6:66148378-66148400 GCTGTAATGTAGGATCTGCATGG - Intergenic
1009991366 6:70846613-70846635 CCTGCAGTGGAGGTGGTGCTGGG + Intronic
1021370698 7:19842224-19842246 CCTGCTATGTACCAGGTGCTGGG + Intergenic
1023508753 7:40927671-40927693 CCTGCAATATATGAGCCTCTTGG + Intergenic
1024056387 7:45662233-45662255 CCTGCCATGCTGGAGCTGCCAGG + Intronic
1024329301 7:48140402-48140424 CATGCAGTGTAAGAGCAGCTAGG - Intergenic
1026513202 7:71044527-71044549 CCTGCAAAGTGGTGGCTGCTGGG + Intergenic
1029559907 7:101295807-101295829 CCTGTAATCTTGGAGCTACTTGG - Intergenic
1029859190 7:103551124-103551146 CCTGCGTAGTAGGTGCTGCTGGG + Exonic
1030196511 7:106858639-106858661 CCTGAAAGGGAGGAGCTTCTGGG - Intergenic
1032238758 7:130145222-130145244 CCTGCCATGTGGCAGCTGATTGG - Intergenic
1033478419 7:141713775-141713797 CCTACTATGTAGCAGATGCTGGG - Intronic
1033999167 7:147390406-147390428 CCAGTAATTTAGGAGCAGCTTGG + Intronic
1034696012 7:153054363-153054385 GCTGCAATTTTGGAGCTTCTTGG + Intergenic
1037612083 8:20484311-20484333 CCTGGACTGTTGGAGCTGCAGGG - Intergenic
1038723616 8:30059837-30059859 CCTTCAATGAAGGAGAGGCTGGG - Intergenic
1040610689 8:48978490-48978512 CCTGGCATGTAGTAGGTGCTGGG + Intergenic
1042686488 8:71447012-71447034 AAAGCAATGTAGGAGCTACTTGG - Intronic
1043944804 8:86237937-86237959 TATGCAATGTAAGAGCAGCTAGG + Intronic
1044597015 8:93969553-93969575 CCTGCAAGGCACGAGCTGGTGGG - Intergenic
1049365017 8:142232908-142232930 CCTGGAAGGGAGGAGCTGCCTGG + Intronic
1050611250 9:7356159-7356181 TCTGGAATGTGTGAGCTGCTGGG + Intergenic
1053055406 9:34990663-34990685 CCTGCAGTGGGGGTGCTGCTGGG - Exonic
1056314446 9:85374453-85374475 CCTTGAATGAAGGAGCGGCTGGG - Intergenic
1056412624 9:86346354-86346376 CTTTCAACGAAGGAGCTGCTAGG - Exonic
1057009812 9:91591118-91591140 CCTGGGATGTCGAAGCTGCTGGG - Intronic
1057283646 9:93730077-93730099 CCTGCAATCTTGGAGTTCCTTGG - Intergenic
1057603057 9:96475703-96475725 CCTGGAAGGTAAGAGCTGCCAGG + Intronic
1058750653 9:108035585-108035607 CCTGCAATGGGGCTGCTGCTGGG - Intergenic
1060298774 9:122361371-122361393 CAAGAAATGAAGGAGCTGCTGGG - Intergenic
1062248562 9:135583041-135583063 GCTGGAGTGTGGGAGCTGCTGGG - Intergenic
1062673788 9:137727724-137727746 TCTGCAATGAAGGAGGTACTGGG + Intronic
1185484840 X:474471-474493 CCTGTATTGTAGGAGTTTCTGGG + Intergenic
1187234735 X:17456673-17456695 CCTGCAAGGTAGCAGCTGGTGGG - Intronic
1193432538 X:81426794-81426816 TCTGAAATGTAGAACCTGCTTGG + Intergenic
1194008249 X:88524079-88524101 CTTGGGATGTATGAGCTGCTAGG + Intergenic
1195868361 X:109458116-109458138 CCTGTAATATAGGAGGTACTAGG - Intronic
1195943004 X:110180537-110180559 CCTGGGATGTCTGAGCTGCTGGG + Intronic
1198986577 X:142461340-142461362 CCTGGAATGTAGTAGGCGCTAGG + Intergenic
1199901519 X:152177242-152177264 CATTCAATGAAGAAGCTGCTGGG + Intronic
1200072170 X:153534614-153534636 CCAGGCATGTAGTAGCTGCTCGG + Intronic