ID: 1102227018

View in Genome Browser
Species Human (GRCh38)
Location 12:111235948-111235970
Sequence CCAACCTGTGAGATTCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102227008_1102227018 30 Left 1102227008 12:111235895-111235917 CCATTAGCAGAAGAGGACCTGGC 0: 1
1: 0
2: 2
3: 6
4: 128
Right 1102227018 12:111235948-111235970 CCAACCTGTGAGATTCAGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 87
1102227013_1102227018 -7 Left 1102227013 12:111235932-111235954 CCCCTTTGTTGGATACCCAACCT 0: 1
1: 0
2: 0
3: 12
4: 92
Right 1102227018 12:111235948-111235970 CCAACCTGTGAGATTCAGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 87
1102227015_1102227018 -9 Left 1102227015 12:111235934-111235956 CCTTTGTTGGATACCCAACCTGT 0: 1
1: 0
2: 0
3: 26
4: 927
Right 1102227018 12:111235948-111235970 CCAACCTGTGAGATTCAGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 87
1102227011_1102227018 13 Left 1102227011 12:111235912-111235934 CCTGGCTTCAGGGAAACAAGCCC 0: 1
1: 0
2: 0
3: 24
4: 192
Right 1102227018 12:111235948-111235970 CCAACCTGTGAGATTCAGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 87
1102227014_1102227018 -8 Left 1102227014 12:111235933-111235955 CCCTTTGTTGGATACCCAACCTG 0: 1
1: 0
2: 1
3: 35
4: 909
Right 1102227018 12:111235948-111235970 CCAACCTGTGAGATTCAGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102227018 Original CRISPR CCAACCTGTGAGATTCAGTC TGG Intronic
908389141 1:63669576-63669598 CCTACCTGAGAGATTAAGGCAGG - Intergenic
908451666 1:64262176-64262198 GCATCCTTTGAGATTCAGTTCGG + Intronic
909994108 1:82258166-82258188 CCACCTTCTGAGATTCAGTAAGG - Intergenic
914331606 1:146676484-146676506 CCACCCTGTGAGATTCTGCCTGG + Intergenic
914463451 1:147906075-147906097 CCAACCTGTGATTTGGAGTCTGG - Intergenic
915033883 1:152906516-152906538 CCAGCCCGTGACAGTCAGTCTGG - Intergenic
915345948 1:155197000-155197022 CCCACCTGTGGGACTCAGGCCGG - Intronic
916078042 1:161214472-161214494 CATTCCTGTTAGATTCAGTCAGG + Intergenic
917443011 1:175083442-175083464 CCAACCTGAGAGGTACAGTTTGG + Intronic
920825050 1:209417176-209417198 CCAACCTCAGAGATTCAGAGAGG + Intergenic
921341414 1:214138080-214138102 ACATCCTGAGAGATTCACTCAGG + Intergenic
924763525 1:247010507-247010529 CCAGCTTGTGAGATGCAGTCAGG + Intergenic
1066438964 10:35419380-35419402 CCAACCTGTGCCATTCTGCCAGG - Intronic
1067386059 10:45818594-45818616 CCCACCTGTGGGTATCAGTCAGG + Intergenic
1067448216 10:46366012-46366034 CCCACCTGTGGGTATCAGTCAGG - Intergenic
1067589161 10:47494754-47494776 CCCACCTGTGGGTATCAGTCAGG + Intergenic
1067636286 10:48002845-48002867 CCCACCTGTGGGTATCAGTCAGG + Intergenic
1067877201 10:50017482-50017504 CCCACCTGTGGGTATCAGTCAGG - Intergenic
1069224956 10:65931623-65931645 CCAACCTCTGATATTCACTTAGG - Intronic
1070132847 10:73666850-73666872 CCCACCTGTGGGTATCAGTCAGG + Intergenic
1071608832 10:87017224-87017246 CCCACCTGTGGGTATCAGTCAGG - Intergenic
1072458074 10:95593972-95593994 CAAAGCTGTGAGAATAAGTCTGG + Intergenic
1074075444 10:110119547-110119569 CTAGCCTGTGAGATTCAGGTAGG + Exonic
1081687341 11:45052186-45052208 TCTACCTGTGAGATTCCATCCGG + Intergenic
1082679562 11:56151950-56151972 GGACCCTGTGAGATACAGTCAGG - Intergenic
1085924729 11:81002839-81002861 CCAAGCTGTGAGCGTCAGTTAGG - Intergenic
1086414007 11:86570702-86570724 CCAATCTTTGAGATTTAGGCTGG - Intronic
1087275057 11:96152874-96152896 CCAATCTGTGAGATTCTGGCAGG - Intronic
1089141033 11:116284293-116284315 CCAACCTGGGAGACTGAGGCAGG - Intergenic
1089339988 11:117750786-117750808 CCAACCTGAGTGATTAATTCAGG - Intronic
1097030548 12:56086521-56086543 CCTACCTCAGAGATTCTGTCAGG + Exonic
1097611282 12:61824259-61824281 CCAACATGTGAGTTGCAGACTGG + Intronic
1102227018 12:111235948-111235970 CCAACCTGTGAGATTCAGTCTGG + Intronic
1102405717 12:112672635-112672657 CCTCCCTGTGGGCTTCAGTCTGG + Intronic
1104298861 12:127544301-127544323 CCAACCTAATAGATTCTGTCAGG + Intergenic
1112833969 13:103490977-103490999 CCACCTTGTGTGATTAAGTCTGG + Intergenic
1113798089 13:113070316-113070338 GGAGCCTGTGAGATTAAGTCAGG + Intronic
1119195674 14:72715230-72715252 CCACCCTGGGAGATTCACACAGG - Intronic
1120204004 14:81568016-81568038 ACAACCTTTGAGATTCATTCTGG - Intergenic
1122617498 14:103030029-103030051 CCACCCTGTGAGAGCCAGTTAGG - Intronic
1123190131 14:106561509-106561531 CCAACCTGTGTGACACAGTGAGG + Intergenic
1124053356 15:26219760-26219782 CCTTCCTGGGAGATGCAGTCAGG - Intergenic
1130266948 15:82414605-82414627 CCATCCTCTGAGATGCTGTCAGG - Intergenic
1131385735 15:92005423-92005445 ACATCCTGTGTGGTTCAGTCTGG + Intronic
1135686652 16:24503221-24503243 CCAGCCTGGGAGACTCTGTCTGG - Intergenic
1139339100 16:66255932-66255954 TCAACCTGTGACTTCCAGTCAGG + Intergenic
1140001949 16:71034416-71034438 CCACCCTGTGAGATTCTGCCTGG - Intronic
1157064914 18:44337476-44337498 CAAACCTATGAGATACAGTGAGG - Intergenic
1157956822 18:52107714-52107736 CCATCCTGTGGCATTAAGTCAGG + Intergenic
1161710194 19:5843425-5843447 CCAGCAGGTGAGATTCAGTGTGG + Exonic
1166890115 19:45986412-45986434 CCCACCTGTGATACTCAGGCAGG + Intergenic
1167877624 19:52427464-52427486 TCAACCTGTGACATCCAGGCTGG - Intergenic
925326268 2:3024291-3024313 CCAACCCCTGAGGTTCAGCCTGG - Intergenic
932003655 2:67906962-67906984 CCAGCCTCTGAGCTTCAGGCAGG + Intergenic
932841703 2:75089049-75089071 TGAACCTGTGTGATTCAGTTAGG - Intronic
933722892 2:85409615-85409637 CCAGGCTGGGAGATTCAGTTTGG - Intronic
937811975 2:126209664-126209686 CCAGTCTGTGAGTTTCAGGCAGG + Intergenic
938084307 2:128388719-128388741 CCAACCTGCCAGGTGCAGTCCGG + Intergenic
942701064 2:178711057-178711079 CAAACCTGTGAGAATGAGCCTGG + Exonic
946245019 2:218382532-218382554 CCACCCAGTGAGATTGAGTCTGG - Intronic
1168824796 20:802826-802848 CCAACGTGTGAGATTAATTTTGG - Intergenic
1169190794 20:3658156-3658178 CCAGCCTCTCAGCTTCAGTCAGG - Intergenic
1171279767 20:23886115-23886137 CAACCCTGTGAGATTCATTCTGG + Intergenic
1173820408 20:46016091-46016113 CCAACCTGTGAGATGCTGTGAGG - Intronic
1177689555 21:24487493-24487515 GCAACTTATGAGATTCACTCAGG - Intergenic
1180243967 21:46533986-46534008 CCAACCTGTGACACACAGACAGG - Exonic
1182087138 22:27569022-27569044 CCAACCTGTGAGGTTCAGGGAGG - Intergenic
955387073 3:58488660-58488682 CCAACCCGTAACATTCAATCTGG - Intergenic
955808904 3:62765490-62765512 ACAACCTGTGACTTTGAGTCAGG - Intronic
960436279 3:117630790-117630812 CCTACCTATGTGTTTCAGTCAGG + Intergenic
967080735 3:186047345-186047367 CCTACCTGTGTGATTCAGTAGGG - Exonic
968250712 3:197209884-197209906 CCAACCAGGGAAATTCAATCAGG - Intronic
969144998 4:5114848-5114870 CCAACCTGTGACATGCAGCATGG - Intronic
970342532 4:15121605-15121627 TCAACATGTTAAATTCAGTCTGG - Intergenic
974335682 4:60541494-60541516 ACAACCTGATAGATTCAGTTTGG - Intergenic
978595484 4:110373166-110373188 TCAATCTGTGAGATTCAGAGGGG - Intronic
980559575 4:134455376-134455398 CCAACAAGTGAGATTAAGTCAGG - Intergenic
982049475 4:151486222-151486244 CCAACCTCTGAGACCCAGACTGG - Intronic
993850239 5:92999464-92999486 CCAACGTGTGTGGTTCATTCTGG + Intergenic
993977237 5:94497256-94497278 TCAATCTGTGAGATTCATTTTGG + Intronic
997296928 5:132774348-132774370 TGAACCTGTGAGATTCTGGCAGG + Intronic
1001315785 5:170640388-170640410 CAAACTTGTGAGATTTAATCAGG - Intronic
1003293872 6:4806361-4806383 CCAAAATGTGAAATTCATTCTGG + Intronic
1009967804 6:70595193-70595215 CCAACCTCTGAGAGTGAGTGAGG - Intergenic
1011282230 6:85688636-85688658 TCAACCTGTTTGTTTCAGTCAGG - Intergenic
1016328471 6:142929894-142929916 TCAGCCTGTCAGATACAGTCTGG - Intronic
1018619258 6:165714654-165714676 CCAAGGAGTGAGTTTCAGTCAGG + Intronic
1018830857 6:167442410-167442432 CCAGCCTGGGAGATTCAGCAAGG + Intergenic
1019844909 7:3488776-3488798 CCAAGCTGTCAGATTGAGTAGGG - Intronic
1023033035 7:36107620-36107642 CCAATCAATGAGCTTCAGTCAGG + Intergenic
1023037958 7:36149408-36149430 CCAATCAATGAGCTTCAGTCAGG - Intergenic
1026381637 7:69805845-69805867 CCTTGGTGTGAGATTCAGTCAGG - Intronic
1030686821 7:112495659-112495681 GCAGCCTTTGACATTCAGTCTGG + Intergenic
1034295847 7:149971862-149971884 CCAACAGCTGAGATGCAGTCAGG - Intergenic
1034810206 7:154125042-154125064 CCAACAGCTGAGATGCAGTCAGG + Intronic
1038633418 8:29266398-29266420 CCAACCTGTGGTAACCAGTCTGG - Intergenic
1045958997 8:107945169-107945191 CCAATCTATGAGATTCAATTTGG + Intronic
1047881394 8:129197893-129197915 CTCACCTGTGGGATTCATTCAGG + Intergenic
1191668284 X:63725378-63725400 CCATCCTGTGAGATACAGTAGGG + Intronic
1202049472 Y:20765711-20765733 CCATCCTCTGAGGTTCACTCTGG - Intronic