ID: 1102227631

View in Genome Browser
Species Human (GRCh38)
Location 12:111240248-111240270
Sequence AAACTGGGCCTCCCAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 456}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102227624_1102227631 13 Left 1102227624 12:111240212-111240234 CCTGTGGCTCTCTGGCATGAGAG 0: 1
1: 0
2: 1
3: 20
4: 165
Right 1102227631 12:111240248-111240270 AAACTGGGCCTCCCAGAGGGTGG 0: 1
1: 0
2: 2
3: 54
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102227631 Original CRISPR AAACTGGGCCTCCCAGAGGG TGG Intronic
900894016 1:5470353-5470375 ACCCAGGGCTTCCCAGAGGGTGG - Intergenic
901796273 1:11681218-11681240 AAACCGGGCCTCGCAGAGGGCGG + Exonic
902556069 1:17247527-17247549 AAACCGAGTCTCCAAGAGGGGGG + Intergenic
902623260 1:17662651-17662673 AAACTGGGCCTGGCAGAGCATGG + Intronic
903188309 1:21641857-21641879 AAAATGAGCCTCTGAGAGGGAGG + Intronic
904344475 1:29859092-29859114 AAACTGGGATTCACAGAGGTTGG + Intergenic
904552147 1:31327819-31327841 AAACAGGGACCCCTAGAGGGGGG + Intronic
905082916 1:35340774-35340796 AAACTGGGCCTCACAGCAGGAGG - Intronic
905932994 1:41802895-41802917 AAGCTAGTCCTCCCAGAGAGAGG + Intronic
906035414 1:42747613-42747635 CAACTGGGCTTCCCAGTGGGCGG - Intronic
907026970 1:51129565-51129587 AAACTGGGTCTCCCGGGGTGTGG - Intronic
907248690 1:53123629-53123651 GGGCTGGGCCTCCCAGAGGAGGG + Intronic
907415457 1:54311150-54311172 GAACTGGCCATCCCAGAAGGGGG + Intronic
907819101 1:57949369-57949391 AAACTGGGCTGCCCAGCAGGAGG - Intronic
909351503 1:74658760-74658782 AAACTGGGTATTTCAGAGGGTGG - Intronic
909423927 1:75499443-75499465 AAACTGGGCCACACAGCAGGAGG - Intronic
909894398 1:81048408-81048430 AAACTGGGCCTTCCTGATGGGGG - Intergenic
911124879 1:94332179-94332201 ACACTGGGCCTGCCTGAGGGTGG + Intergenic
915167776 1:153958202-153958224 AACCTGCGCCTCCCAAACGGCGG + Intronic
915279699 1:154814052-154814074 GAGGTGGGCCTCCCAGAGAGTGG + Intronic
915505958 1:156356704-156356726 CAACTTGGCCTCCCACAGTGTGG + Intronic
915962045 1:160275067-160275089 GAACTGGGCCTCACAGCAGGAGG + Intergenic
916735485 1:167603409-167603431 GCATTGGGCCACCCAGAGGGGGG - Intergenic
920448629 1:206039608-206039630 TCACTGGACCACCCAGAGGGAGG - Intronic
920559446 1:206928837-206928859 AAACTGTGCCTCCAACAGAGGGG + Exonic
920575701 1:207058741-207058763 CAACTTGGCCTCCCAAAGTGAGG + Intronic
920814510 1:209318793-209318815 AACCTGAGACTCCTAGAGGGTGG + Intergenic
921021269 1:211237852-211237874 AACCTCGGCCTCCCAAAGTGCGG - Intergenic
921928533 1:220733358-220733380 GAACTGGGGCTCCTACAGGGCGG + Intergenic
924053887 1:240105355-240105377 CACCTCGGCCTCCCAGAGTGTGG + Intronic
924224355 1:241908546-241908568 CACCTGGGCCTCCCAAAGTGCGG - Intergenic
1063102029 10:2958736-2958758 AAACTGTTCTTCCCAGAGGTCGG + Intergenic
1064668869 10:17687405-17687427 AACCTCCGCCTCCCAGAGGGGGG - Intronic
1065823969 10:29552807-29552829 AAAATGGGTTTGCCAGAGGGTGG - Intronic
1066671502 10:37845095-37845117 AACCTCTGCCTCCCAGAGGCTGG + Intronic
1066696612 10:38084689-38084711 ACACTGGGCCTACATGAGGGTGG + Intergenic
1066995934 10:42563044-42563066 ACACTGGGCCTACATGAGGGTGG - Intergenic
1068334846 10:55621456-55621478 GAACTGGGCCTCACAGCAGGTGG + Intronic
1068596129 10:58904953-58904975 AAAATGAAGCTCCCAGAGGGAGG + Intergenic
1068987818 10:63123252-63123274 AGAGTGGGCCTGCCTGAGGGTGG - Intergenic
1069926601 10:71854987-71855009 AGACTTGAGCTCCCAGAGGGTGG - Intergenic
1070293048 10:75134167-75134189 ACACTGGGCCTGTCAGTGGGGGG + Intronic
1070847177 10:79532827-79532849 CACCTGGGCCTCCCAGAGCAGGG - Intergenic
1070926621 10:80227451-80227473 CACCTGGGCCTCCCAGAGCAGGG + Intergenic
1071138854 10:82483300-82483322 TGACTGGGTCTCCCAGATGGAGG + Intronic
1072888067 10:99297739-99297761 ACCCTGGGCCACCCAGGGGGTGG - Intergenic
1073498969 10:103918656-103918678 AACCTGGGCCTCCTAGAGGTTGG + Intergenic
1075639342 10:124053573-124053595 AACCTCTGCCTCCCAGAGGTTGG + Intronic
1075849245 10:125573989-125574011 AAACCGGGTCTCCCTGAGCGAGG + Intergenic
1076999705 11:316390-316412 CAAGTTTGCCTCCCAGAGGGCGG + Intergenic
1077058230 11:606257-606279 CACCGGGGCCTCCCAGAGGGAGG - Intronic
1077333380 11:1993086-1993108 AACCTGGGCTGCCCAGAGGTAGG + Intergenic
1077381278 11:2239786-2239808 ACACTGGGCCTACTAGGGGGTGG + Intergenic
1077802830 11:5558611-5558633 ACACTGGGTCTACCAGAGGGTGG - Intronic
1078423342 11:11229972-11229994 AAACTGGGCTTCAGAGAGGAGGG + Intergenic
1078826345 11:14934373-14934395 GAACTGGGCCTCACAGCAGGAGG - Intronic
1079316187 11:19409764-19409786 AAACTGAGACTCACAGAGGGTGG + Intronic
1080404814 11:31969628-31969650 AAGCTGGGACTCACTGAGGGAGG + Intronic
1080487594 11:32727397-32727419 AAGCTCTGCTTCCCAGAGGGAGG + Intronic
1080770453 11:35336150-35336172 ACACTGGGCCTCTCAGGGGGTGG + Intronic
1081035192 11:38135280-38135302 CAACTTGGCCTCCCAAAGTGTGG - Intergenic
1081979752 11:47258925-47258947 CACCTGGGCCTCCCAAAGTGTGG - Exonic
1083618893 11:64039335-64039357 GGCCTGGGCCTCCCAGAGGCTGG - Intronic
1084134012 11:67161111-67161133 CAACTTGGCCTCCCAAAGTGTGG - Intronic
1084401899 11:68949017-68949039 GAACTGGGCCTCACAGCAGGAGG + Intergenic
1084589471 11:70082074-70082096 AAACTGAGGCTCCCAGTTGGGGG + Intronic
1085654043 11:78296187-78296209 GAACTGGGCCTCACAGCAGGAGG - Intronic
1086022802 11:82252370-82252392 CAACTTGGCCTCCCAAAGTGTGG - Intergenic
1086651724 11:89299664-89299686 AAACTGGGGCACACAGAGGTAGG - Intergenic
1087132580 11:94681160-94681182 AAAGTGGGCTTCCCAGAGGAAGG - Intergenic
1087738919 11:101865670-101865692 TGCCTTGGCCTCCCAGAGGGAGG - Intronic
1089254088 11:117184973-117184995 CACCTTGGCCTCCCAGAGTGTGG + Intronic
1090114085 11:123947703-123947725 AAACTCGGCCTCCCATATGCAGG - Intergenic
1090305987 11:125691720-125691742 CACCGGGGCCTGCCAGAGGGTGG + Intergenic
1090779136 11:129991433-129991455 CACCTGGGCCTCCCAAAGTGCGG - Intronic
1091068471 11:132540925-132540947 AAAAGGAGACTCCCAGAGGGAGG - Intronic
1202816358 11_KI270721v1_random:48267-48289 AACCTGGGCTGCCCAGAGGTAGG + Intergenic
1091774633 12:3176329-3176351 AAACTGAGCGTCCAAGAGAGGGG + Intronic
1093633058 12:21432992-21433014 ACACTGGGCCTGTCTGAGGGTGG - Intergenic
1094439294 12:30457055-30457077 AAGCTGCGCCACCCTGAGGGAGG + Intergenic
1094871990 12:34603879-34603901 AACCTGGGCCTCCCGTTGGGCGG - Intergenic
1098378560 12:69843928-69843950 AAACTGAGCCTCCCTGATGGGGG + Intronic
1098606681 12:72398963-72398985 GAACTGGGCCTCTCAGTGGGAGG + Intronic
1098658739 12:73067437-73067459 AAGATGGAGCTCCCAGAGGGAGG - Intergenic
1098857407 12:75668459-75668481 CACCTTGGCCTCCCAAAGGGCGG + Intergenic
1099230351 12:80016289-80016311 AAACTCTGATTCCCAGAGGGAGG + Intergenic
1099446619 12:82760629-82760651 AAACTGGGCCACACAGCAGGAGG + Intronic
1100833570 12:98542611-98542633 CACCTGGGCCTCCCAAAGTGCGG - Intronic
1101687878 12:107043770-107043792 ACATCTGGCCTCCCAGAGGGAGG + Intronic
1102227631 12:111240248-111240270 AAACTGGGCCTCCCAGAGGGTGG + Intronic
1102228224 12:111244378-111244400 CAGCTGGGCTTCCCAGAGGACGG - Intronic
1102317726 12:111903423-111903445 CAACTTGGCCTCCCAAAGTGTGG - Intergenic
1102587652 12:113934336-113934358 AAACTGAGCCTCAGAGAGGCAGG + Intronic
1103719183 12:122964395-122964417 AAACTGAGGCCCACAGAGGGAGG + Intronic
1103733901 12:123046275-123046297 CAAGTGTGCCTGCCAGAGGGTGG - Intronic
1104007530 12:124904468-124904490 ACACTGGGCCCCACAGAAGGGGG + Intergenic
1105736997 13:23281836-23281858 GAACTGGGCCTCACAGCAGGAGG - Intronic
1106297133 13:28425107-28425129 AATCTGGGCCTCACACAGGTAGG + Intronic
1107014201 13:35695663-35695685 CACCTGGGCCTCCCCGTGGGTGG + Intergenic
1108720208 13:53123825-53123847 CACCTGGGCCTCCCAAAGTGCGG - Intergenic
1109921220 13:69062363-69062385 ACAATGGGCCTATCAGAGGGTGG + Intergenic
1110167164 13:72457243-72457265 AAACTGGGCCTGACATATGGTGG - Intergenic
1110330888 13:74270982-74271004 GAACTGGGCCGCACAGAAGGAGG + Intergenic
1111046374 13:82819376-82819398 AAACTGGGCCGCGCAGCAGGAGG + Intergenic
1111130600 13:83970225-83970247 CAACTCGGCCTCCCAAAGGCTGG - Intergenic
1112204403 13:97309690-97309712 AATGTGGGCCTCTCAGAGGATGG + Intronic
1112339758 13:98543425-98543447 AAACTGCACCTCTCAGAGTGGGG + Intronic
1113746031 13:112745311-112745333 CACCTGGGCCTCCCAAAGTGTGG + Intronic
1115275959 14:31608797-31608819 AAACTGGGCCACACAGCAGGAGG - Intronic
1115753400 14:36512545-36512567 AAATTGGGCCCCACAGAGGGTGG + Intronic
1115761474 14:36581860-36581882 ACACTGGCCATCCCAGACGGAGG + Intronic
1116058155 14:39888914-39888936 AAACTGGGCCACCCAGCAGGAGG + Intergenic
1116716370 14:48431494-48431516 AAACTTGACCTCAGAGAGGGTGG - Intergenic
1116824630 14:49660641-49660663 GGCCTCGGCCTCCCAGAGGGAGG - Intronic
1117717221 14:58593750-58593772 AAACTGGGCCACCCAGCAGGAGG + Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1119112179 14:71985368-71985390 CACCTTGGCCTCCCAGAGTGCGG + Intronic
1119357999 14:74022966-74022988 CAACCTGGCCTCCCAAAGGGAGG - Exonic
1119567570 14:75641537-75641559 AAACTGAGGTTCCCAGAGGTTGG - Intronic
1120107038 14:80507760-80507782 AAAATGCGCCTACCAGAGGAAGG + Intronic
1120602597 14:86530509-86530531 GAACTGGGCCTCACAGCAGGAGG + Intergenic
1121326160 14:93020777-93020799 AAACTGAGGTTCCTAGAGGGCGG - Intronic
1122668223 14:103349285-103349307 CACCTGGGCCTCCCAAAGTGCGG - Intergenic
1122695650 14:103550908-103550930 ATACTGGAGCTCCCAGTGGGAGG - Intergenic
1122854712 14:104554546-104554568 AAAGTAGGCCTTTCAGAGGGAGG - Intronic
1123039973 14:105486498-105486520 AAGCGGGGACTCCCAGAGAGGGG - Intergenic
1202899135 14_GL000194v1_random:25692-25714 AAACTGCGCCGCCCAGAAGTGGG - Intergenic
1123757949 15:23411680-23411702 CATCTCGGCCTCCCAAAGGGTGG + Intergenic
1123922370 15:25079366-25079388 AATCTTGGCCACCCAGAGGCAGG - Intergenic
1125287848 15:38113029-38113051 AAATTGAGTCTCACAGAGGGAGG + Intergenic
1125510882 15:40291720-40291742 ATACTGCGACTCCCAGGGGGCGG - Intronic
1125780756 15:42264861-42264883 ACACTGGGCCTACTTGAGGGTGG - Intronic
1126721132 15:51581107-51581129 GAACTGGGCCTCACAGCAGGAGG + Intronic
1126864178 15:52919763-52919785 AAACTGGGGCTTATAGAGGGTGG + Intergenic
1127956017 15:63854199-63854221 ACACTGGGGCTACTAGAGGGGGG + Intergenic
1128146422 15:65334664-65334686 AGACCGGCCCTCCCAGGGGGTGG + Intronic
1128760764 15:70214779-70214801 AACCTGGTCCTGCCACAGGGTGG + Intergenic
1129040652 15:72683590-72683612 CAACTTGGCCTCCCAAAGTGTGG - Intronic
1130337829 15:82972596-82972618 CACCTGGGCCTCCCAGGTGGAGG + Intronic
1130398465 15:83526648-83526670 ACACTGGGCCTTCCAGAGGGTGG + Intronic
1130909254 15:88259736-88259758 AAACTGGGTATCTCAGAGGCAGG + Intergenic
1131269714 15:90939628-90939650 TTACTGTGCCTCCCAGAGTGAGG + Intronic
1131798105 15:96041284-96041306 ACACTGGGCCTCTCAGAGAGTGG + Intergenic
1131804619 15:96108519-96108541 AAACTGGGCTTCACAGCAGGAGG + Intergenic
1131859312 15:96635738-96635760 AGACTGGGCTTCCCAGTGGGTGG - Intergenic
1133759770 16:8789194-8789216 CACCTTGGCCTCCCAAAGGGTGG - Intronic
1134379036 16:13707360-13707382 GAACTGGGCCACCCAGCAGGAGG + Intergenic
1134647377 16:15880682-15880704 AAACTGGGCCACACAGCAGGAGG + Intronic
1135782541 16:25317178-25317200 ACTTTGGGCCTACCAGAGGGTGG + Intergenic
1136178830 16:28537400-28537422 AAACTGGGGCTCCTCCAGGGTGG - Intronic
1136293616 16:29290003-29290025 ACACTGGGCCTGCCACAGGGAGG - Intergenic
1137046655 16:35670101-35670123 CACCAGGGCCTGCCAGAGGGTGG + Intergenic
1137556501 16:49473726-49473748 TCACTGGGGCTCCCAGAGGCGGG - Intergenic
1138306751 16:55984118-55984140 ACACTGGGCCTATCAGATGGCGG - Intergenic
1138462098 16:57155517-57155539 CAACTTGGCCTCCCAAAGTGTGG - Intronic
1138471889 16:57244832-57244854 AAATTGCGCCTCCCTGAGTGTGG - Intergenic
1139315316 16:66062615-66062637 AACGTGTGCCTCCCAAAGGGAGG + Intergenic
1140320745 16:73949464-73949486 GAACTGCTCCTCTCAGAGGGAGG - Intergenic
1140896619 16:79330551-79330573 ATACTGGGCCACCCACAGGGTGG + Intergenic
1141169049 16:81679833-81679855 AAACTGGGGCTCCCAGAACCAGG - Intronic
1141249239 16:82339722-82339744 AAACTGGGGCTTTCAGAGGAAGG + Intergenic
1141805612 16:86339445-86339467 ACACTGGGCCTCCTCAAGGGTGG - Intergenic
1142099498 16:88264009-88264031 ACACTGGGCCTGCCACAGGGAGG - Intergenic
1142114691 16:88350493-88350515 AAACTGAGGCTCTGAGAGGGAGG - Intergenic
1143469769 17:7165261-7165283 AACCTAGGCATCCCAGAGTGGGG - Intergenic
1144074576 17:11705101-11705123 AAACTGGGCATCACAGATGTTGG - Exonic
1144393627 17:14820737-14820759 CACCTGGGCCTCCCAAAGGACGG - Intergenic
1144596391 17:16573728-16573750 AGACTGGGCCTCCCTGAGGATGG + Intergenic
1145191678 17:20846476-20846498 GAACTGGGCCTCACAGCAGGTGG + Intronic
1145401889 17:22546473-22546495 GAACTGGGCCTCACAGCAGGAGG + Intergenic
1146907273 17:36625909-36625931 GAGCTGGGCCTCCCAGAAAGTGG - Intergenic
1148230424 17:45929946-45929968 GAACTTGGCTTGCCAGAGGGTGG - Intronic
1148388440 17:47253476-47253498 AAACAGGGTCTCCCAGGAGGCGG + Intergenic
1148457338 17:47818167-47818189 AAACTGGGGCTCCCTGAGGCAGG + Intronic
1149864878 17:60145788-60145810 AGGCTGGGACTCCCAGCGGGAGG + Intergenic
1150571285 17:66389300-66389322 CACTTGGGCCTCCCAGAGGCAGG + Intronic
1151817049 17:76476507-76476529 AAAATGGAACCCCCAGAGGGTGG - Intronic
1151835747 17:76581605-76581627 ACACCAGGCCTCCCTGAGGGTGG - Intronic
1151952575 17:77363321-77363343 AAAGTGGGCCACCCAGAGGTGGG + Intronic
1152281821 17:79389356-79389378 AAAGGGGGCCTCCCAGGGGCAGG - Intronic
1152685392 17:81691338-81691360 AAGCTGGGCCTCACAGGTGGGGG - Intronic
1153227706 18:2910624-2910646 GAACAGGGCCTCCTGGAGGGGGG + Intronic
1153781629 18:8500110-8500132 GAACTTGGCCTCCTGGAGGGAGG + Intergenic
1153954700 18:10086439-10086461 GTCCTGTGCCTCCCAGAGGGTGG - Intergenic
1154653247 18:17092959-17092981 AAACTGCGCCTTCAAAAGGGTGG - Intergenic
1154691109 18:17611170-17611192 AAACTGCGCCTTCCAAACGGTGG - Intergenic
1154706760 18:17825588-17825610 AAACTGCGCCTTCCAAACGGTGG - Intergenic
1155923220 18:31626534-31626556 AAACTGGGCCGCACAGCAGGAGG + Intronic
1157375669 18:47162094-47162116 GAACTGGGCCACCCAGCAGGAGG - Intronic
1157685394 18:49639022-49639044 CAGCTGGGCCCCCCAGTGGGAGG + Intergenic
1158509672 18:58079516-58079538 AAACTGAGCCTCAGAGAGGTTGG + Intronic
1159102936 18:63975274-63975296 GAACTGGGCCAACCAGAAGGTGG - Intronic
1159937316 18:74379643-74379665 AAACTGGGCCACACAGCAGGAGG - Intergenic
1160802656 19:977436-977458 CATCTGGGCCGCACAGAGGGCGG - Intergenic
1161024271 19:2028390-2028412 AAACTGAGTCTCCCTGGGGGTGG + Intronic
1161455528 19:4367966-4367988 AAATGGAGGCTCCCAGAGGGAGG + Intronic
1162525451 19:11203817-11203839 AAGCTGGCCCTGGCAGAGGGAGG + Intronic
1162878386 19:13638096-13638118 ATACTGGGCATACCACAGGGTGG + Intergenic
1164850308 19:31477811-31477833 CACCTTGGCCTCCCAAAGGGCGG + Intergenic
1164987632 19:32660292-32660314 CGACTTGGCCTCCCAAAGGGAGG - Intronic
1166197281 19:41215530-41215552 AACCTGGGCCTCCTAAAGTGTGG + Intergenic
1166304062 19:41927921-41927943 AAGCTGGGCCTCCGAGCCGGTGG - Intronic
1166527496 19:43521578-43521600 GAACTGAGGCTCCCAGAGGGAGG + Intronic
1167119439 19:47507825-47507847 AAGCTGGGGCTCAGAGAGGGCGG + Intronic
1167241017 19:48343065-48343087 AAACTGAGGCTCGGAGAGGGAGG - Intronic
1202648310 1_KI270706v1_random:159973-159995 AAACTGCGCCGCCCAGAAGTGGG + Intergenic
925399589 2:3562658-3562680 CAACGGGGCCTACCTGAGGGTGG - Intergenic
925825246 2:7841952-7841974 GAACTGGGCCGCCCAGCAGGAGG - Intergenic
927108580 2:19848193-19848215 AAACTAGGCCACCCAATGGGGGG + Intergenic
928608691 2:32969434-32969456 AAACTGGGCCTACGTGAGGGTGG - Intronic
929055846 2:37875424-37875446 GGACTGGGGCTCCCAGAGGATGG + Intergenic
929627977 2:43429918-43429940 CACCTGGGCCTCCCAAAGTGTGG - Intronic
930016717 2:46975661-46975683 AACCAGAGCCTCCCAGAAGGGGG - Intronic
930454218 2:51584361-51584383 CACCTGGGCCTCCCAAAGTGCGG + Intergenic
930908135 2:56598539-56598561 ACACTGGGCCTTTCAGGGGGTGG - Intergenic
931774771 2:65531140-65531162 AAACTGGGCCACACAGCAGGAGG - Intergenic
933076190 2:77930088-77930110 AAACTGGGCCGCACAGCAGGAGG - Intergenic
933143778 2:78825754-78825776 ACACAGGGCCTACCTGAGGGAGG + Intergenic
933989049 2:87620377-87620399 AAACTGTGCCTGCCATGGGGTGG + Intergenic
936304794 2:111330449-111330471 AAACTGTGCCTGCCATGGGGTGG - Intergenic
936741295 2:115512346-115512368 CACCTAGGCCTCCCAAAGGGAGG + Intronic
937223606 2:120355882-120355904 AAAGAGGGCCTCTCAGAGGAAGG - Intergenic
938039944 2:128067440-128067462 TAACTCGGCCTCCCAAAGTGCGG - Intergenic
938489757 2:131755384-131755406 AAACTGCGCCGCCCAGAAGTGGG + Intronic
940009909 2:149041632-149041654 AAACTGTGTCTCCCAGAGGTGGG + Intronic
940116325 2:150212509-150212531 AATCTGGGACTTCCAGTGGGTGG + Intergenic
940810259 2:158234961-158234983 CAATGGGGCCTTCCAGAGGGTGG + Intronic
940988882 2:160077617-160077639 AAACTGGGGTTCCCAGAGTCAGG - Intergenic
941372219 2:164679766-164679788 ACACTGGGCCTCTCGGGGGGTGG + Intronic
941518179 2:166505756-166505778 AATCTGGGCCTGTCAGAGGGTGG - Intergenic
943551940 2:189351963-189351985 ACACTGGGCCTGTCTGAGGGTGG - Intergenic
944870004 2:203900670-203900692 GAACTGGGCCTGCCACAGGCAGG - Intergenic
945366829 2:208964916-208964938 CACCTGGGCCTATCAGAGGGTGG + Intergenic
946599309 2:221342070-221342092 ACACTGGGCCTACATGAGGGTGG + Intergenic
946694567 2:222341289-222341311 CCACTGGGCCTATCAGAGGGTGG - Intergenic
946839555 2:223807015-223807037 CACCTTGGCCTCCCAAAGGGTGG - Intronic
946909115 2:224442784-224442806 AAACTGGGCCTCCCTCTAGGCGG + Intergenic
947309476 2:228784775-228784797 CAACAGGGCCTGTCAGAGGGTGG + Intergenic
948441862 2:237996971-237996993 CACCTGGGCCTCCCAAAGTGCGG - Intronic
1168959405 20:1858438-1858460 ACACTGGGCCTTCTTGAGGGAGG - Intergenic
1169010831 20:2248903-2248925 CACCTTGGCCTCCCAGAGTGTGG + Intergenic
1169193575 20:3672077-3672099 AAACTGGCCCCACCAGAGGATGG + Intronic
1169945524 20:10984192-10984214 AAACTGGGCCTAGCAGAGGTAGG + Intergenic
1170052334 20:12159537-12159559 AAACTGAGACACCCAGAGTGGGG - Intergenic
1170163202 20:13336860-13336882 ACCCTGGGCCTCCCAGTTGGGGG + Intergenic
1171057603 20:21922618-21922640 GAACTGGGCCTATCAGAGGGTGG - Intergenic
1171276670 20:23861928-23861950 CATCGGGGCCTGCCAGAGGGTGG - Intergenic
1171365697 20:24622452-24622474 AAACTGGGCCACACAGCAGGAGG + Intronic
1172050007 20:32110031-32110053 AAAATGGGGCTCACAGTGGGCGG - Intronic
1174167046 20:48592534-48592556 GAACTGGGCCGCCCAGCAGGAGG - Intergenic
1174365278 20:50053016-50053038 AGACTGGGCCACCCACAGGCCGG - Intergenic
1175234391 20:57499903-57499925 GAACTGGGCCTCCCAGCAGGAGG - Intronic
1175594849 20:60222771-60222793 AGACTGTGCAGCCCAGAGGGAGG + Intergenic
1175827269 20:61942926-61942948 GAGCTGGGCTGCCCAGAGGGAGG - Intergenic
1175902300 20:62364774-62364796 TAGCTGGGCATCCCAGATGGGGG - Intronic
1176603540 21:8812718-8812740 AAACTGTGCCGCCCAGAAGTGGG - Intergenic
1176618518 21:9040461-9040483 AAACTGTGCCGCCCAGAAGTGGG - Intergenic
1176706419 21:10122365-10122387 AAACTGCGCCGCCCAGAAGTGGG + Intergenic
1176898316 21:14409848-14409870 AAACAGGGCCTACTTGAGGGTGG - Intergenic
1178174745 21:30083632-30083654 AAACTGGGGCTTAGAGAGGGAGG - Intergenic
1178908786 21:36657668-36657690 ACACTGGGCCTTTCTGAGGGTGG + Intergenic
1179534112 21:42040212-42040234 CAACTGAGCCCCTCAGAGGGAGG - Intergenic
1180345823 22:11704275-11704297 AAACTGTGCCGCCCAGAAGTGGG - Intergenic
1180353591 22:11822520-11822542 AAACTGCGCCGCCCAGAAGTGGG - Intergenic
1181571794 22:23771930-23771952 AAACTGAGGCTCCAAGAGGGAGG - Intronic
1181915443 22:26276054-26276076 AAACTGGGGCTCTGAGAGAGAGG - Intronic
1182549250 22:31092153-31092175 AAACTGAGGCTCAGAGAGGGTGG + Intronic
1183080586 22:35453222-35453244 ACACTGGGCCTCACAGAGCCTGG + Intergenic
1183296174 22:37030805-37030827 AAACTGAGGCTCCGAGAGGTTGG - Intergenic
1183369178 22:37422932-37422954 AAACTGGGCCTCGGGGGGGGGGG + Intronic
1183718752 22:39549956-39549978 AAACTGGGCCTGGCACATGGTGG + Intergenic
1184239623 22:43205310-43205332 ACACTGGGGCTCAGAGAGGGCGG - Intronic
1184767988 22:46581974-46581996 CACCTGGGCCTCCCTGTGGGAGG - Intronic
1184880150 22:47299508-47299530 CAAATGAGCCTCCCAGAGTGTGG - Intergenic
949921652 3:9008008-9008030 AAACTGGCTCTCCCAGACTGTGG + Intronic
950130728 3:10544576-10544598 AATCTGAGCCTCCCAAAGTGTGG - Intronic
951259220 3:20486740-20486762 ACACTGGGCCTACCTGAGGGTGG - Intergenic
951968871 3:28420463-28420485 ACACAGGGCCTACTAGAGGGTGG - Intronic
952232394 3:31445495-31445517 CACCTGGGCCTCCCAAAGTGCGG - Intergenic
952809259 3:37386884-37386906 AATCTGGGCCTCTCAGAGGAAGG + Intronic
952824062 3:37510251-37510273 CACCTTGGCCTCCCAGAGTGCGG + Intronic
953280913 3:41556010-41556032 ACACTGGGCCTTTCAGAGGGTGG + Intronic
953694633 3:45147609-45147631 ATACAGGCCCTCCCAGAGGTGGG - Intergenic
954308895 3:49749151-49749173 GAACTGGGCCTCACAGCAGGAGG - Intronic
954699491 3:52443846-52443868 AGACTGGGCTTCCCAGGGGAAGG + Intronic
954976576 3:54700942-54700964 ATGCTGGGACTCTCAGAGGGAGG - Intronic
956112603 3:65884752-65884774 ACACTGGGCCTCCCAAAGTGGGG - Intronic
956714866 3:72070160-72070182 GAACTGGGCCTCACAGCAGGAGG + Intergenic
956901963 3:73726225-73726247 AAACTGGGGCTCTGTGAGGGAGG + Intergenic
957115175 3:76014677-76014699 CACCTGGGCCTCCCAAAGTGCGG - Intronic
957459094 3:80494312-80494334 GTACTGGGCCTCACAGAAGGAGG + Intergenic
958589781 3:96141014-96141036 ACACTGGGCCTACTTGAGGGTGG + Intergenic
958661918 3:97079432-97079454 ACACTGGGCCTATCAGAGGGTGG + Intronic
959588886 3:108053677-108053699 TAACTGGGCCTCACAGGGGTGGG - Intronic
961311857 3:126007433-126007455 AAGCTGGGCCCACTAGAGGGAGG - Intronic
961537189 3:127577295-127577317 AAGCTGGGGCCCCGAGAGGGAGG - Intronic
962650400 3:137483115-137483137 ACACTGGGCCTTTCAGAGGGTGG + Intergenic
963698690 3:148596804-148596826 AAACTGGGTCTTTCGGAGGGTGG - Intergenic
965221883 3:165936414-165936436 CACCTGGGCCTGTCAGAGGGTGG + Intergenic
965569879 3:170161607-170161629 GAACTGGGCCTCACAGCAGGAGG - Intronic
968258372 3:197298650-197298672 CAACTGCACCTCCCAGGGGGCGG + Intronic
968662845 4:1805922-1805944 GTACTTGGCCTCCCAGAAGGTGG + Exonic
968975118 4:3818075-3818097 GGGCTGGGCTTCCCAGAGGGGGG + Intergenic
968976636 4:3825493-3825515 AAACAGGGCCTGCCACATGGTGG + Intergenic
969401636 4:6959528-6959550 ACACTGTGCTTCCCAGAGGCGGG - Intronic
969469863 4:7381475-7381497 AAACTGGGCTTCCTGCAGGGAGG - Intronic
970176236 4:13342123-13342145 ACACTGGGACTCACAGATGGGGG - Intergenic
971522725 4:27574798-27574820 CACTGGGGCCTCCCAGAGGGTGG - Intergenic
973238669 4:47933195-47933217 AAACTGAGTCTCACTGAGGGAGG - Intronic
973265682 4:48208068-48208090 GAACTTGGCTTCCCAGAGGCAGG + Intronic
973386496 4:49517356-49517378 AAACTGCGCCCCCCAGAAGTGGG - Intergenic
973914103 4:55615789-55615811 ACACAGGGCCTGCTAGAGGGTGG - Intronic
974056632 4:56989774-56989796 AAGCTGGGCATCACAGAGGCTGG - Intronic
974059197 4:57014750-57014772 CACCTCGGCCTCCCAGAGTGCGG + Intronic
974252347 4:59403033-59403055 ACACTGAGGCTACCAGAGGGTGG + Intergenic
975144338 4:70951187-70951209 GAACTGGGCCTCACAGCAGGAGG + Intronic
975789211 4:77930296-77930318 GAACTGGGCCTCACAGCAGGAGG + Intronic
976829545 4:89298896-89298918 AATCTGAGCCTCCGAGAGGGAGG - Intronic
977613214 4:99058264-99058286 AAACTGGTCCTTGAAGAGGGTGG + Intronic
979224556 4:118269438-118269460 ACACTGGGCCTACCTGAGGGCGG - Intergenic
979512782 4:121573287-121573309 ACACTGGGCCTGTCAGGGGGTGG + Intergenic
979531189 4:121770762-121770784 AAATTGGGCAGTCCAGAGGGGGG + Intergenic
980531693 4:134064757-134064779 ACACTGGGCCTACTAGAGGGTGG - Intergenic
981246401 4:142544746-142544768 AGACTGCGCCTGCCAGAGGAGGG + Intronic
981520059 4:145651989-145652011 GAACTGGGCCTCACAGCAGGGGG - Intronic
982146828 4:152403773-152403795 GAACTGGGCCTCACAGCAGGAGG - Intronic
982231468 4:153211736-153211758 CACCTGGGCCTCCCAAAGTGCGG + Intronic
984418926 4:179494895-179494917 CACCTGGGCCTCCCAAAGTGCGG + Intergenic
984457691 4:179991781-179991803 ATACTGGGTCTACCAGAGGGTGG + Intergenic
984736109 4:183109677-183109699 GAACTGGGCCGCACAGAAGGAGG - Intronic
985668531 5:1194396-1194418 ACACTGGGCCTGTCAGAGGGTGG - Intergenic
985968554 5:3356362-3356384 AAAATGGTCCTCCCACATGGTGG - Intergenic
986426909 5:7641683-7641705 ACACTGGGACTACTAGAGGGAGG - Intronic
986710850 5:10486946-10486968 AGCCTGCGCCTCCCGGAGGGAGG + Intergenic
987002156 5:13670736-13670758 CACCTGGGCCTACCTGAGGGTGG + Intergenic
987133188 5:14878309-14878331 GAACTGGGCCGCACAGTGGGAGG + Intergenic
987618807 5:20311629-20311651 ACACTGGGCCTGTCAGAGGATGG + Intronic
989039835 5:37216293-37216315 ATCCTGGGCCTCCCAAAGTGTGG - Intronic
989704779 5:44315970-44315992 GAACTGGGCCACACAGCGGGAGG + Intronic
990603467 5:57384338-57384360 ACACTGGGCCTCTTTGAGGGCGG + Intergenic
991725979 5:69536420-69536442 CACCTGGGCCTCCCAAAGTGTGG - Intronic
991868977 5:71091447-71091469 CACCTGGGCCTCCCAAAGTGTGG + Intergenic
993414493 5:87609633-87609655 TCACTGGGACTCCAAGAGGGAGG - Intergenic
994705792 5:103205011-103205033 ACACTGGGCCTGTCAGTGGGTGG - Intronic
997210360 5:132073500-132073522 AAACTGTGCCCCTCAGAGGGAGG + Intergenic
998072712 5:139210822-139210844 AAACCGGGCCTCACAGCAGGAGG + Intronic
999716181 5:154362129-154362151 AAACTGGGCACCCCAGCAGGAGG + Intronic
999736178 5:154515006-154515028 AAAGGGGGACTCACAGAGGGAGG - Intergenic
999762071 5:154710145-154710167 AAACTGGGCCCCACAGCAGGAGG - Intergenic
1000284733 5:159817155-159817177 CACCTTGGCCTCCCAAAGGGGGG + Intergenic
1000368155 5:160510152-160510174 AAACTGGGACTGCCAGAGAAAGG - Intergenic
1002042132 5:176522049-176522071 AAACTGGCCCTCCCAAAGGACGG - Intergenic
1002189278 5:177470378-177470400 AGACAGGTCCTCTCAGAGGGAGG - Intronic
1002958184 6:1888992-1889014 CAACTAGGCCTCCCAAAGGAGGG + Intronic
1005116357 6:22342332-22342354 CAACGGGGCCTATCAGAGGGTGG - Intergenic
1005750332 6:28876115-28876137 CACCTCGGCCTCCCAGAGTGTGG + Intergenic
1005768319 6:29037384-29037406 CACCTGGGCCTACCTGAGGGTGG - Intergenic
1006335775 6:33419969-33419991 AATCTGGGCCTCCCGGAGTAGGG + Intergenic
1006499351 6:34448122-34448144 AGACTCCGCCTCCCAGTGGGAGG + Intergenic
1006919756 6:37619592-37619614 AGACTGGGGCTCCCTGAGGATGG - Intergenic
1006924006 6:37644281-37644303 AGACTGGGGCTCCCTGAGGATGG + Intronic
1007066934 6:39000424-39000446 AAACTGGGCCACACAGCAGGAGG + Intronic
1007073857 6:39054497-39054519 AGACTGGGGCTCCCTGAGGACGG - Intronic
1007088611 6:39167937-39167959 AGACTGGGGCTCCCTGAGGACGG - Intergenic
1007105547 6:39280880-39280902 AGACTGGGGCTCCCTGAGGACGG + Intergenic
1007105569 6:39280958-39280980 AGACTGGGGCTCCCTGAGGACGG + Intergenic
1007105601 6:39281075-39281097 AGACTGGGGCTCCCTGAGGACGG + Intergenic
1007210742 6:40191887-40191909 AGACTGGGGCTCCCTGAGAGTGG - Intergenic
1007210762 6:40191964-40191986 AGACTGGGGCTCCCTGAGGGTGG - Intergenic
1007210786 6:40192041-40192063 AGACTGGGGCTCCCTGAGGATGG - Intergenic
1007210825 6:40192196-40192218 AGACTGGGGCTCCCTGAGGATGG - Intergenic
1007215609 6:40235067-40235089 GGAATGGGGCTCCCAGAGGGAGG + Intergenic
1007223100 6:40294292-40294314 AAACTGGGGCTTCCCGAGGACGG - Intergenic
1007223166 6:40294762-40294784 AGACTGGGGCTCCTAGAGGATGG - Intergenic
1007244019 6:40447030-40447052 AGACTGGGGCTCCCTGAGGATGG + Intronic
1007256979 6:40536297-40536319 AGACTGGGGCTCCCTGAGGACGG - Intronic
1007273037 6:40652855-40652877 ATACTGGGGCTCCCTGAGGATGG - Intergenic
1007276759 6:40679772-40679794 AAACTGGGGCTCTCTGAGGATGG - Intergenic
1007284479 6:40737895-40737917 AGACTGGGGCTCCCTGAGGACGG + Intergenic
1007284506 6:40738014-40738036 AGACTGGGGCTCCCTGAGGATGG + Intergenic
1007286510 6:40751791-40751813 AGACTGGGGCTCCCTGAGGACGG + Intergenic
1007424981 6:41740862-41740884 AGACTGGGGCTCCCTGAGGATGG + Intronic
1007427657 6:41757770-41757792 AGACTGGGGCTCCCCGAGGACGG + Intergenic
1007427670 6:41757809-41757831 AGACTGGGGCTCCCCGAGGACGG + Intergenic
1007427683 6:41757848-41757870 AGACTGGGGCTCCCCGAGGATGG + Intergenic
1007427696 6:41757887-41757909 AGACTGGGGCTCCCCGAGGATGG + Intergenic
1007427709 6:41757926-41757948 AGACTGGGGCTCCCCGAGGATGG + Intergenic
1007427733 6:41758004-41758026 AGACTGGGGCTCCCTGAGGATGG + Intergenic
1007707134 6:43797954-43797976 AGACTGGGGCTCCCTGAGGATGG - Intergenic
1007707156 6:43798031-43798053 AGACTGGGGCTCCCTGAGGATGG - Intergenic
1007707195 6:43798184-43798206 AGACTGGGGCTCCCTGAGGATGG - Intergenic
1007707207 6:43798222-43798244 AAACTGGGGCTCCCTGAGTCAGG - Intergenic
1007736678 6:43986406-43986428 AGACTGGGGCTCCCTGAGGATGG + Intergenic
1007736923 6:43987623-43987645 AGACTGGGGCTCCCTGAGGATGG - Intergenic
1007740044 6:44004585-44004607 AGACTGGGGCTCCCTGAGGACGG + Exonic
1007747254 6:44050899-44050921 AGACTGGGGCTCCCTGAGGACGG + Intergenic
1007750156 6:44066521-44066543 AGACTGGGGCTCCCTGAGGATGG + Intergenic
1007750238 6:44066827-44066849 AGACTGGGGCTCCCTGAGGATGG + Intergenic
1009443055 6:63705376-63705398 GAACTGGGCCTCACAGCAGGAGG + Intronic
1010290699 6:74133285-74133307 AAACTGGGCCACACAGCAGGTGG + Intergenic
1010326958 6:74575511-74575533 ACACTGGGCCTACTTGAGGGTGG - Intergenic
1010593719 6:77739556-77739578 ACACTGGGCCTGTCAGGGGGTGG + Intronic
1014541005 6:122676373-122676395 GAACTGGGCCACACAGCGGGAGG - Intronic
1016521408 6:144950961-144950983 AAACTTGGCCTTCCAGAGTAGGG + Intergenic
1017220070 6:151955880-151955902 ACACTGGGCCTACGTGAGGGAGG - Intronic
1017441164 6:154465511-154465533 GAACTGAGGCACCCAGAGGGAGG + Intronic
1017781685 6:157720390-157720412 AACCAGGGCCTTCCTGAGGGAGG - Intronic
1019279084 7:191400-191422 AAACTGAGGCTCAGAGAGGGCGG + Intergenic
1019280278 7:196258-196280 GGCCTGGGCCTCCCAGATGGAGG + Intronic
1019493373 7:1325263-1325285 GAGCTGGGCCCCCCAGAGGGAGG + Intergenic
1019906383 7:4068327-4068349 AAACTGAGGCCCCGAGAGGGTGG + Intronic
1020663348 7:11008385-11008407 GAACTGGGCCTCACAGCAGGGGG + Intronic
1020877171 7:13712534-13712556 ACACTGGGCCTACCTGAGGGTGG + Intergenic
1021748709 7:23773200-23773222 ACACTGGGCCTGTCAGGGGGTGG - Intronic
1021998505 7:26202169-26202191 GACTTGGGCCTCCCGGAGGGCGG + Intronic
1022412431 7:30149397-30149419 AAACCGGCCCTGCCAGAGGGCGG - Intronic
1023728749 7:43170065-43170087 GAACTGGGCCTCACAGCAGGAGG + Intronic
1023742577 7:43293821-43293843 AAACTGGGCCACACAGCAGGAGG + Intronic
1023831836 7:44043992-44044014 AAACTGGTGCTCCCAGGAGGAGG + Intergenic
1024053914 7:45647253-45647275 GAACTGGGGCTCCCAGCGGTCGG + Intronic
1024456080 7:49608615-49608637 ACACTGGGCCTACCTGAGAGTGG - Intergenic
1026414480 7:70163732-70163754 AAACTTGGCTTCCCCGTGGGAGG + Intronic
1027154662 7:75758168-75758190 GAACTGGGCCTCACAGCAGGAGG - Intergenic
1029283794 7:99452822-99452844 AAACCGAGACTACCAGAGGGAGG + Intronic
1029605694 7:101598347-101598369 CAACGGGGCCTCCCAGCTGGAGG + Intergenic
1029883953 7:103847401-103847423 CACCAGGGCCTGCCAGAGGGTGG + Intronic
1031269772 7:119633885-119633907 ACACTGGGCCTTTCAGAGGGTGG - Intergenic
1034007724 7:147492320-147492342 TAACTGGGCCTCACAGCAGGAGG - Intronic
1034420240 7:150986759-150986781 AAACTGGGCCAGGCTGAGGGTGG + Intergenic
1035221138 7:157407154-157407176 AGACTGGGCTTCCCAGAGCCAGG + Intronic
1035259370 7:157651994-157652016 AAAATGGGCCTCCCAGGCGCAGG - Intronic
1035274849 7:157741638-157741660 AAAACTGACCTCCCAGAGGGAGG - Intronic
1035606771 8:934543-934565 CAGCTGCGCCTCCCAGGGGGTGG + Intergenic
1036748025 8:11424019-11424041 GAACTGGGATTCCCAAAGGGAGG - Exonic
1037066982 8:14593924-14593946 AATCTCGGCCTCCCAAAGTGCGG - Intronic
1037549492 8:19956609-19956631 CACTGGGGCCTCCCAGAGGGTGG - Intronic
1037920332 8:22801302-22801324 AGACTGGGGCTCACAGAGGCAGG + Intronic
1038324439 8:26561874-26561896 GAACTGGGCCTCACAGTAGGAGG - Intronic
1039022955 8:33227610-33227632 AAAGTGGGCCTCCCAGTGCCTGG + Intergenic
1039088478 8:33803062-33803084 ATACTAGGTCTCCCTGAGGGTGG + Intergenic
1039092791 8:33850248-33850270 ACACTGGACCTCCTAGAGAGGGG - Intergenic
1039286828 8:36050857-36050879 AGAATGGGCCTCCCAAAGAGTGG + Intergenic
1040087463 8:43360426-43360448 AAACTGGGCCACACAGCAGGAGG + Intergenic
1043067203 8:75589949-75589971 ACACTGGGCCTACTTGAGGGTGG - Intergenic
1044067733 8:87719519-87719541 CATCGGGGCCTCCTAGAGGGTGG + Intergenic
1044413669 8:91912234-91912256 CACTTGGGCCTACCAGAGGGTGG + Intergenic
1046137052 8:110041124-110041146 ACACTGGGCCTACTTGAGGGTGG - Intergenic
1046446294 8:114324930-114324952 CACCGGGGCCTGCCAGAGGGTGG + Intergenic
1046458461 8:114501691-114501713 ACACTGGGCCTTTCAGAGGGAGG + Intergenic
1046696712 8:117348978-117349000 CAACTTGGCCTCCCAAAGTGTGG - Intergenic
1047052656 8:121130110-121130132 AAACTGAGACTGTCAGAGGGAGG - Intergenic
1048587031 8:135783624-135783646 GAACTGGGCCGCCCAGCAGGAGG + Intergenic
1049342380 8:142120105-142120127 AAGCTCAGCCTCCCTGAGGGTGG - Intergenic
1049378492 8:142300821-142300843 AATCTGGGCCTCCCAGGCGCCGG + Intronic
1049559655 8:143303231-143303253 CACCTCGGCCTCCCAAAGGGCGG + Intergenic
1050054143 9:1634283-1634305 ACACTGGGCCTACTTGAGGGTGG + Intergenic
1050536028 9:6631481-6631503 AAAAGGGGCCTCCCACAGGAAGG - Intronic
1051037828 9:12770346-12770368 ATGCTGGGCCTCCCAGAAGCTGG + Intergenic
1051878263 9:21813198-21813220 AAACTGGACCTCTAAGATGGAGG - Intronic
1052512136 9:29435310-29435332 AAACTGGGCCGCACAGCAGGAGG - Intergenic
1053535786 9:38924104-38924126 ACACTGGGACTCCTAGAAGGGGG + Intergenic
1053643710 9:40109488-40109510 AAACTGCGCCGCCCAGAAGTGGG + Intergenic
1053762443 9:41356002-41356024 AAACTGCGCCGCCCAGAAGTGGG - Intergenic
1054208008 9:62148517-62148539 ACACTGGGACTCCTAGAAGGGGG + Intergenic
1054324565 9:63706719-63706741 AAACTGCGCCGCCCAGAAGTGGG + Intergenic
1054541040 9:66267119-66267141 AAACTGCGCCGCCCAGAAGTGGG - Intergenic
1054630346 9:67439833-67439855 ACACTGGGACTCCTAGAAGGGGG - Intergenic
1054838448 9:69706531-69706553 AAACTTGGCCTCCCAGTGATGGG + Intergenic
1055369882 9:75586209-75586231 CACCAGGGCCTCCCTGAGGGTGG + Intergenic
1056117471 9:83454815-83454837 AAACAGAGCCTGACAGAGGGTGG - Intronic
1057250026 9:93493719-93493741 ACACTGGGCCCCCAGGAGGGAGG - Intronic
1058719093 9:107747416-107747438 AAACTGGGCATCTCAGAGCACGG - Intergenic
1059019010 9:110553119-110553141 CAACTGGGCATCTCAGAGGATGG + Intronic
1059723579 9:116985090-116985112 AAACTGAGCCCCAGAGAGGGAGG - Intronic
1059824540 9:118013472-118013494 ACACTGGGGCTTCCAGAGGGTGG - Intergenic
1061098909 9:128477298-128477320 CACCTCGGCCTCCCAGAGTGTGG - Intronic
1061217821 9:129231885-129231907 AAACTGAGGCTCACAGAGGTGGG + Intergenic
1061254200 9:129444588-129444610 AAAGGAGGCCTCCCAGAGGACGG + Intergenic
1061282398 9:129604946-129604968 AAACTGGGTTTCCCAGTGGGAGG + Intergenic
1061411578 9:130424916-130424938 AAACAGGGCCTCCCCCAGGTGGG + Intronic
1062058838 9:134483693-134483715 AAACTGGACCTGCCACAGCGCGG + Intergenic
1062359420 9:136180610-136180632 TACCTGGGCCCTCCAGAGGGAGG + Intergenic
1202791457 9_KI270719v1_random:92454-92476 AAACTGCGCCGCCCAGAAGTGGG + Intergenic
1203698249 Un_GL000214v1:116036-116058 AAACTGCGCCGCCCAGAAGTGGG + Intergenic
1186378202 X:9031605-9031627 CAACTGGGCCTACTTGAGGGTGG + Intronic
1186980257 X:14950981-14951003 AAACTGAGGCTCACAGAGGTCGG + Intergenic
1187096639 X:16155786-16155808 AAATTGAGCCTCCCTGAGGCAGG + Intergenic
1187693270 X:21893367-21893389 AAACTGGGCTGCACAGCGGGAGG - Intergenic
1188147095 X:26627662-26627684 CACCAGGGCCTCCCTGAGGGAGG - Intergenic
1188593754 X:31871464-31871486 AAACTGAGGCTCACAGAGAGAGG + Intronic
1188768907 X:34129529-34129551 CACCTGGGCCTCCCAAAGCGGGG + Intergenic
1188835056 X:34945119-34945141 CACCTGGGCCTCCCAAAGTGGGG - Intergenic
1189007707 X:37011868-37011890 CATCTGGGCCTCCCAAAGGCGGG - Intergenic
1189040778 X:37540709-37540731 CACCTGGGCCTCCCAAAGTGGGG + Intronic
1190258083 X:48779553-48779575 AAACTGGGCCACACAGCAGGAGG + Intergenic
1192922940 X:75726678-75726700 CATCTGGGCCTTCCTGAGGGTGG - Intergenic
1193136153 X:77972748-77972770 CACCTGGGCCTCCCAGAGTGCGG + Intronic
1193789180 X:85797608-85797630 GAAATGGAGCTCCCAGAGGGAGG - Intergenic
1194067876 X:89284447-89284469 AGAATGGAGCTCCCAGAGGGAGG - Intergenic
1194320189 X:92436800-92436822 AAAGGGGGCCTCCTTGAGGGTGG + Intronic
1194878877 X:99225348-99225370 ACAGTGGGCCTCCTTGAGGGTGG - Intergenic
1194888920 X:99353927-99353949 AAGCAGTGCCCCCCAGAGGGGGG + Intergenic
1196128086 X:112120971-112120993 AACTGGGGCCTACCAGAGGGTGG + Intergenic
1196484545 X:116190006-116190028 AAACTGGGCCTGTCGGGGGGTGG - Intergenic
1197718270 X:129726186-129726208 CAACTGGGGACCCCAGAGGGTGG - Intergenic
1197761831 X:130033466-130033488 AAAGTGGGGCTCAGAGAGGGAGG + Intronic
1197971644 X:132120706-132120728 GATGTGGGGCTCCCAGAGGGTGG + Intronic
1199330058 X:146548990-146549012 AAAGTGGGCCTAACTGAGGGTGG - Intergenic
1200022548 X:153224412-153224434 AAACTGGGCCACACAGCAGGAGG - Intergenic
1200215392 X:154365963-154365985 AGTCTGGGCCTCCCACAGGAGGG - Intronic
1200628311 Y:5549932-5549954 AAAGGGGGCCTCCTTGAGGGTGG + Intronic
1202328008 Y:23712924-23712946 AACCTGGGCCTCCCAGATTCAGG - Intergenic
1202542762 Y:25957128-25957150 AACCTGGGCCTCCCAGATTCAGG + Intergenic