ID: 1102227675

View in Genome Browser
Species Human (GRCh38)
Location 12:111240429-111240451
Sequence TGTTAGCTTGAGTGCTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102227675 Original CRISPR TGTTAGCTTGAGTGCTGTGG GGG (reversed) Intronic
905479703 1:38253024-38253046 GGTTAGGTTAAGTGCTGTGCTGG + Intergenic
906499511 1:46331246-46331268 TATTCTCTTGACTGCTGTGGGGG + Intergenic
908034128 1:60033615-60033637 TGTGAGCTGGAGTGCTGAGGTGG + Exonic
912453965 1:109785607-109785629 TGTGGGGTTGAGGGCTGTGGTGG + Intergenic
912870791 1:113303425-113303447 TGTTAGCAGGAGTCCTGGGGCGG + Intergenic
915742367 1:158128707-158128729 TGTTATCTTGATTGCAGCGGTGG - Intergenic
916573719 1:166049191-166049213 TGTTAGTGTAAGTGCTGTGAAGG - Intergenic
917537142 1:175882525-175882547 TGTTACTCTGAGTGCAGTGGGGG + Intergenic
919713193 1:200748899-200748921 GGTTACCCTGAGTGCTGTGTGGG + Intronic
920291164 1:204924035-204924057 TCTTAGCTCCAGTGGTGTGGAGG - Intronic
921354209 1:214270454-214270476 TGCTTTCTTGTGTGCTGTGGAGG - Intergenic
922987069 1:229874138-229874160 TGATAGGTTGGGTGTTGTGGGGG + Intergenic
923689587 1:236179178-236179200 TGTTAGCTTGTGTGCCATAGGGG - Intronic
924043264 1:240004467-240004489 TGTAAGATTCAGTGCTTTGGGGG + Intergenic
924294474 1:242571194-242571216 TCTTAGCTTGAGTGTTGGAGTGG + Intergenic
1063289914 10:4734626-4734648 TCTGAGCCTGAGTGCAGTGGCGG - Intergenic
1063698423 10:8360348-8360370 CGTTAGCTTCAGGGCTCTGGAGG - Intergenic
1064107698 10:12513967-12513989 TGTTCGCTTGACTGCAGCGGTGG + Intronic
1064661957 10:17616224-17616246 TCTTGGCTGGAGTGCAGTGGCGG - Intronic
1064925802 10:20567527-20567549 TCTTAGCTTCAGGGCTGTGTTGG - Intergenic
1065583812 10:27198400-27198422 TGGCATCTTGAGTGCTGGGGAGG - Intronic
1067030157 10:42874517-42874539 AGTTTCCTTGACTGCTGTGGTGG + Intergenic
1069801752 10:71085996-71086018 TGCTCGCTGGAGTGCTGTGTTGG + Intergenic
1073059862 10:100727173-100727195 TTTTGGCTGGAGTGCAGTGGCGG + Intergenic
1073230061 10:101961642-101961664 TGTTAGCATGAGCTCTGTGTTGG - Intronic
1073433087 10:103499506-103499528 TTTCAGCTGGAGTGCAGTGGTGG + Intronic
1075385164 10:122050335-122050357 CCTTACCTTGAATGCTGTGGTGG + Intronic
1078467782 11:11562922-11562944 TGTGAACTTGAGGGCTGTGGGGG - Intronic
1083088087 11:60170683-60170705 TGGTATCCAGAGTGCTGTGGTGG + Intergenic
1084341037 11:68501368-68501390 TGTAAGCTGGAGGGCAGTGGCGG + Intronic
1084466219 11:69324526-69324548 TGATAGTTTTAGTGATGTGGTGG + Intronic
1084589316 11:70080916-70080938 TGTTGGCTTGAGTGGTGCCGGGG - Intronic
1086760409 11:90623435-90623457 TCTCAGCTTGACTGCTGTTGGGG - Intergenic
1090055932 11:123425048-123425070 TGTGAGCATTAGTGCTGTGTAGG - Intergenic
1091485891 12:887947-887969 TGCTCACTTGAGTGCAGTGGTGG + Intronic
1093471136 12:19503395-19503417 TGTCAGCTTGAGTGTTATTGGGG + Intronic
1094709245 12:32944610-32944632 TGTTAGCTTCAGTGCTAAGTGGG + Intergenic
1097509224 12:60515282-60515304 TGTTATTTTGAGTGTTGTGTGGG - Intergenic
1100852935 12:98732306-98732328 TGTTTGCTTGAGTTCGGTTGGGG + Intronic
1100987518 12:100217559-100217581 TGTGAGCTGTAGTGCTGAGGGGG - Intronic
1101306289 12:103530868-103530890 TGTTATAATGAGAGCTGTGGCGG - Intergenic
1102227675 12:111240429-111240451 TGTTAGCTTGAGTGCTGTGGGGG - Intronic
1104808363 12:131604108-131604130 TCTTCCCTGGAGTGCTGTGGAGG - Intergenic
1105383706 13:19911097-19911119 TTTTGGCTGGAGTGCAGTGGTGG + Intergenic
1105648187 13:22343861-22343883 TGTTAGCTTGATTGTGTTGGTGG + Intergenic
1111632325 13:90858164-90858186 TGTTGGCTTGAGACCTCTGGAGG + Intergenic
1111998633 13:95189868-95189890 TGCTGGATTGAATGCTGTGGTGG - Intronic
1112089790 13:96070600-96070622 TGTTGGCTTGTTTGGTGTGGAGG - Intergenic
1112337354 13:98526065-98526087 TGGTGGCTGGAGTGCGGTGGAGG + Intronic
1113219872 13:108087614-108087636 TGTTAGCTTGAGTTCCCTGTAGG + Intergenic
1115359747 14:32488040-32488062 TCAGAGCTTGAGTGCTGTGTTGG + Intronic
1115396732 14:32917622-32917644 TCTGAGCTAGGGTGCTGTGGTGG - Intergenic
1115653288 14:35419238-35419260 TGTTAGCAAGAGTGCTAAGGAGG + Intergenic
1118441733 14:65818371-65818393 TGTGAGATTGTGTGGTGTGGGGG - Intergenic
1122036761 14:98954566-98954588 TGTCATCTTGTGTGCTGTGAGGG - Intergenic
1125270746 15:37936075-37936097 TGTTAGATTGAGCACTTTGGAGG + Intronic
1126691155 15:51289867-51289889 TGGTAGCATGAATGCTGTGTAGG - Intronic
1127277443 15:57459768-57459790 TCTGAGCTTGAGTGCTGAGGGGG + Intronic
1127760571 15:62135701-62135723 TGTTAGTTTAAGTGGGGTGGGGG - Intergenic
1129321188 15:74775880-74775902 TGGTGGCTTGAGTGGTGTGGTGG - Intergenic
1133116671 16:3581545-3581567 GGTTGGCCTGAGTGCTGAGGAGG + Exonic
1133336495 16:5009925-5009947 GGGTAGCTTGAGTGCTGGGGAGG + Intronic
1135926319 16:26696993-26697015 TGTAGGCTAGAGTGCAGTGGTGG - Intergenic
1139284539 16:65798633-65798655 TGTTTGCTTGAGAGCTTTGCAGG - Intergenic
1139287588 16:65829467-65829489 TGTGAGCTAGTGTGCTCTGGTGG - Intergenic
1140555622 16:75917693-75917715 TGCCAGCAAGAGTGCTGTGGGGG - Intergenic
1142479297 17:208367-208389 TGTCAGCTTCAGAGCTGAGGTGG - Intergenic
1142986003 17:3695723-3695745 TGTGAGCCTGCTTGCTGTGGGGG - Intronic
1143214837 17:5217029-5217051 TGTTAGGTTGAGTGCAGACGGGG + Intronic
1143447752 17:7019079-7019101 TGTTAGTTTGGGGGCTATGGAGG - Intergenic
1146001452 17:29133026-29133048 TGTTAACTTGGGTGCCGGGGTGG + Intronic
1146279851 17:31538009-31538031 GCTTAGCTTTAGTGCTGGGGTGG + Exonic
1150159816 17:62886784-62886806 TGTTATTTTGAGTTTTGTGGAGG - Intergenic
1160419268 18:78732870-78732892 TGTTTGCTGGAGTGCTGTTCTGG + Intergenic
1161501324 19:4617656-4617678 TGTTGGAATGGGTGCTGTGGAGG - Intergenic
1165050782 19:33140120-33140142 TGTTATCCTGTGGGCTGTGGGGG - Intronic
1165421350 19:35723539-35723561 TGTTAGAGTTTGTGCTGTGGAGG + Intronic
925651476 2:6094080-6094102 TGTTAGTTTCTCTGCTGTGGTGG + Intergenic
927834999 2:26388752-26388774 TGTGAATTTGAGTGCTCTGGAGG + Intronic
930182684 2:48379751-48379773 TGTAGGCTGGAGTGCAGTGGTGG - Intergenic
931445915 2:62327111-62327133 TGTTAGTATGTGTGCTGTGGTGG + Intergenic
931538727 2:63305224-63305246 TTAGAGCTTGAGTGCTGTGCTGG - Intronic
931830264 2:66043748-66043770 TCTTAGATTGCGTGCTCTGGAGG + Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
935818225 2:106867816-106867838 TGTTTGCTTGTGTCCCGTGGAGG + Intronic
936006401 2:108892647-108892669 TGTTAGCTTCAGTGGTTGGGAGG + Intergenic
940128840 2:150358601-150358623 TCTTAGCTTGTCAGCTGTGGAGG - Intergenic
943267936 2:185760832-185760854 TGTTATCTTGAATGCAGTGATGG + Intronic
945222222 2:207496537-207496559 TGTGAGCGTCATTGCTGTGGTGG - Intergenic
945684607 2:212953805-212953827 CCTTAGCTTAAATGCTGTGGTGG + Intergenic
1171333111 20:24358605-24358627 CGTTAGCATGAGTGCTTTTGAGG - Intergenic
1173688890 20:44943447-44943469 TTTTACCTTGAGTGCTTTGTGGG + Exonic
1174976618 20:55342967-55342989 TGAAAGTTTGAGTGCTGTGCTGG + Intergenic
1176051037 20:63119917-63119939 GGCTGGCTTGGGTGCTGTGGAGG - Intergenic
1176102334 20:63370232-63370254 TCTTGACTTGAGTGCTGGGGAGG - Intronic
1180246636 21:46552927-46552949 TGTAACCTGGAGTGCTGGGGAGG + Intronic
1183504404 22:38201407-38201429 CGCTAGCTTGAGTCCTGAGGTGG + Intronic
1183813420 22:40277820-40277842 TGCTAGCTTGATTGCTGTTTGGG - Intronic
1184336569 22:43856700-43856722 TGTTAGCTTGCGTTCAGTGGAGG - Intronic
1184675019 22:46036851-46036873 TGTTAGCCTGTGTGCTGAGCCGG + Intergenic
1184924655 22:47628764-47628786 TGTGAGCGTGTGTGTTGTGGGGG + Intergenic
951774799 3:26297879-26297901 TTTTAGATTGATTGCTGTCGGGG + Intergenic
953213155 3:40894040-40894062 TGTTGGCTTGTGTGCTTTGACGG - Intergenic
954772879 3:52988964-52988986 TGTTAGATTGAAAGGTGTGGGGG - Intronic
955574495 3:60345278-60345300 TGTTACCTGGTGTGCTGTGTTGG - Intronic
959570010 3:107872988-107873010 TGTTGTCTGGAGTGCTGTGGTGG - Intergenic
962440593 3:135411655-135411677 TCTTGGCTTTAGTGCTGTGCTGG + Intergenic
963765411 3:149329932-149329954 TGTTATCTTGACTGCAATGGTGG + Intronic
963817479 3:149848020-149848042 TGTAAACTGGAGTGTTGTGGTGG + Intronic
968107691 3:196014090-196014112 TGTTGACTTGAGTGTTGTGGTGG + Intergenic
968107732 3:196014250-196014272 TGTTGACTTGGGTGTTGTGGTGG + Intergenic
968434434 4:577015-577037 AGTGAGCCTGGGTGCTGTGGGGG + Intergenic
971267909 4:25111084-25111106 TGACAGCTTGTGTCCTGTGGGGG - Intergenic
973814410 4:54605754-54605776 CGTTAAATTGAGTCCTGTGGAGG + Intergenic
975294347 4:72715188-72715210 TTTGTGCTTGTGTGCTGTGGGGG - Intergenic
978275228 4:106941174-106941196 AGTTAGGTAGAGTTCTGTGGTGG - Intronic
978800897 4:112754449-112754471 TGTTAGCTTGTGAGCTGAGTTGG + Intergenic
980737423 4:136908632-136908654 TGTGATATGGAGTGCTGTGGCGG + Intergenic
980938939 4:139254217-139254239 TGTGAGCTTGTGAGCTGAGGAGG - Intergenic
981609921 4:146582371-146582393 AGGTAGCTGGAGTGATGTGGAGG + Intergenic
983703701 4:170631321-170631343 TGTTGGCTTGCTTGCAGTGGTGG + Intergenic
986635644 5:9819734-9819756 TATAAGCTTGCCTGCTGTGGAGG - Intergenic
989527093 5:42466115-42466137 TGGGAGCTTGAGTTGTGTGGAGG + Intronic
991490622 5:67179387-67179409 AGTTAGCCTGAAGGCTGTGGAGG - Intergenic
994430978 5:99660990-99661012 TGTTAGCTTGAGCGCTTGGATGG + Intergenic
994748341 5:103707149-103707171 TGTCAGCTTCAGTCCAGTGGTGG + Intergenic
996933066 5:128914526-128914548 TATTACCTGGAGTGCAGTGGAGG - Intronic
997682046 5:135763611-135763633 TGTTGGCTTGAGTGGTGCTGAGG - Intergenic
1001225051 5:169936994-169937016 TGGTAGCTTGAACACTGTGGAGG + Intronic
1002412937 5:179098126-179098148 TGTTGGCTAAAGTGCTCTGGGGG - Intergenic
1004744829 6:18499427-18499449 TGTTACTTTGAGTGCTGAGAAGG + Intergenic
1007268023 6:40611936-40611958 TGGTAGCTGGAGTGCTGGAGAGG - Intergenic
1007546713 6:42699856-42699878 TGTTTGCTGGAGTGCAGTGGTGG - Intronic
1007566616 6:42856227-42856249 GGATAGCTTGAGTTCTGAGGTGG + Intronic
1007715191 6:43851624-43851646 TGTGTGCTTGAGAGCAGTGGGGG + Intergenic
1007728869 6:43933626-43933648 TGTTAGGATGTCTGCTGTGGTGG + Intergenic
1008007935 6:46432174-46432196 TGTAAGCTTTAGTGTTTTGGGGG + Intronic
1008431981 6:51429038-51429060 TGTTAACTGCAGTGCTGTGGTGG + Intergenic
1009799353 6:68514382-68514404 TGGTACCTTGATTGCAGTGGTGG - Intergenic
1011920635 6:92572428-92572450 TTTTAACTTGAGTGCTTTTGTGG + Intergenic
1012003710 6:93685638-93685660 AGTGAGATTGAGTGCTGTGTTGG + Intergenic
1013282020 6:108647351-108647373 TTGTAGCTGGAGTGCTGTGCTGG + Intronic
1016563181 6:145420185-145420207 TATTGGCTTGAATACTGTGGTGG - Intergenic
1017579021 6:155840187-155840209 TGTTAGCTTGCTTTCCGTGGGGG - Intergenic
1019784695 7:2967900-2967922 AGTGAGCTTAAGTGCTGTGACGG + Intronic
1021621141 7:22552156-22552178 TGTTTCCTTGAGGGCTGTGAGGG + Intronic
1024060594 7:45695579-45695601 TGAAATCTTGACTGCTGTGGAGG - Intronic
1026185367 7:68078826-68078848 TTTTAGCTTCAGTGCTTTGGAGG - Intergenic
1026549238 7:71353068-71353090 TGCTAGCCTGAGGGCTTTGGGGG + Intronic
1027440620 7:78215629-78215651 TGCTGCCTGGAGTGCTGTGGTGG + Intronic
1031897751 7:127371970-127371992 TATTAGTTTGAGTGCTGTGAGGG - Intronic
1032665522 7:134032533-134032555 TGTTGGCTTCACTGCTGTGAGGG - Intronic
1032801130 7:135317983-135318005 TGGTTTCCTGAGTGCTGTGGGGG - Intergenic
1041087167 8:54267583-54267605 TGTTAGCCTGAGTCCTGGGCTGG + Intergenic
1043211316 8:77522038-77522060 TGTAATCTTCAGTGCTGTGGAGG - Intergenic
1046777674 8:118180927-118180949 TGTCAGCCTGAGTACTGTGGGGG + Intergenic
1048757156 8:137752486-137752508 TGTTAGCTAAACTGCTGTAGTGG - Intergenic
1049839805 8:144763666-144763688 TGTTAGCACGACTCCTGTGGGGG + Intergenic
1057645512 9:96871208-96871230 TGTATGCTTCAGTGCTCTGGAGG - Intronic
1059142925 9:111871011-111871033 TGATTGCTTGTGTGCTGTTGGGG + Intergenic
1059938471 9:119335003-119335025 TGTTAGAGTGAGTGATGGGGTGG + Intronic
1060972534 9:127746893-127746915 TGTGGGCTGGAGTGCAGTGGTGG - Intronic
1188492086 X:30748603-30748625 TATTGGCTGGGGTGCTGTGGAGG - Intergenic
1188699391 X:33239212-33239234 TGGTGGCTGGAGTGCAGTGGTGG - Intronic
1192403759 X:70863199-70863221 TCAGAGCTTGAGTGCTGTGCTGG - Intronic
1194973402 X:100368815-100368837 TGTTGGCTTAAGGCCTGTGGTGG - Intronic
1196582223 X:117392001-117392023 TGTTAGCTGGAGAGCACTGGTGG - Intergenic
1199144120 X:144346140-144346162 TCTTAGCTTGAGTGCTTTATGGG + Intergenic
1199637187 X:149825257-149825279 TGTTGGGTTGAGTGCTTTGGCGG - Intergenic
1200794696 Y:7330120-7330142 TGTTATTATCAGTGCTGTGGCGG - Intergenic
1201232664 Y:11879854-11879876 TGCCAGCTTGAGTTCTGTGTAGG - Intergenic
1202039454 Y:20667042-20667064 TGTTACCCTGAGTTCTGAGGTGG - Intergenic