ID: 1102228009

View in Genome Browser
Species Human (GRCh38)
Location 12:111242786-111242808
Sequence GTTGATGGATGCAGCTGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102228009_1102228011 -6 Left 1102228009 12:111242786-111242808 CCGGGGCAGCTGCATCCATCAAC 0: 1
1: 0
2: 3
3: 15
4: 143
Right 1102228011 12:111242803-111242825 ATCAACCCATCATCTATATTAGG 0: 53
1: 1262
2: 2203
3: 3053
4: 4176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102228009 Original CRISPR GTTGATGGATGCAGCTGCCC CGG (reversed) Intronic
901242228 1:7702189-7702211 GGTCATGGCTGCAGCAGCCCAGG - Intronic
902597623 1:17520162-17520184 GTTGATGGATGGCTCAGCCCCGG + Intergenic
903747585 1:25598562-25598584 GGTGGTGGCTGCAGCTCCCCTGG + Intergenic
906241990 1:44247896-44247918 GACGATGGATGGAGCTGCCGGGG + Intronic
911707376 1:101029136-101029158 ATTGATGGCTGCAACTTCCCTGG - Intergenic
913942259 1:125119572-125119594 TATGCTGGCTGCAGCTGCCCAGG - Intergenic
916175358 1:162033567-162033589 TCTGGTGGCTGCAGCTGCCCAGG + Intergenic
920500668 1:206483046-206483068 GTGGATGGCAGCAGCTGCCCAGG - Intronic
920990849 1:210937919-210937941 ATAAATGGATGCAGCTTCCCAGG - Intronic
922860484 1:228811861-228811883 CTAGAAGGATCCAGCTGCCCTGG - Intergenic
924797395 1:247301973-247301995 GGTGATGGATAAAGCTGCTCTGG + Intronic
1065529715 10:26656113-26656135 ATTGATGGATGCAACAGACCAGG - Intergenic
1067039250 10:42940255-42940277 GGTGATGGATGCAGCCCACCAGG + Intergenic
1069933740 10:71900971-71900993 GTGGATGGGTGCAGCCGGCCTGG + Intergenic
1072450417 10:95535101-95535123 GTAGATGGATACAGATGCCCAGG + Intronic
1075274022 10:121077437-121077459 GTTGCTGAAAGCAGCTGTCCAGG - Intergenic
1076786332 10:132751778-132751800 CTGGATGGAGGCAGGTGCCCAGG + Intronic
1077348279 11:2074924-2074946 GTAGAATGATGCAGCTGCGCTGG - Intergenic
1079080417 11:17410104-17410126 GTGGATGGATGCACCACCCCGGG - Intronic
1084444762 11:69197089-69197111 GTTCATGGATCCAGCAGGCCGGG + Intergenic
1084444943 11:69198133-69198155 GTGCTTGGATGAAGCTGCCCTGG - Intergenic
1085078962 11:73618180-73618202 GTTGCTGGGTGCAGTTGCTCAGG + Intergenic
1089362731 11:117901773-117901795 TTTGGTGGATGCAGCTTCCCAGG - Intronic
1089457819 11:118635386-118635408 GTTGAAGGAGGCAGAGGCCCTGG + Exonic
1089475245 11:118754494-118754516 GTTCTTGAATGCAGCTTCCCGGG - Intronic
1091670231 12:2447280-2447302 GTTTAGGGAGGCAGCTGCCTTGG - Intronic
1091987719 12:4926221-4926243 GTCCATGGGTGCAGCTGCCCTGG + Intronic
1092125672 12:6073618-6073640 GTGGATGGCTGCAGCTGCCCTGG - Exonic
1092257229 12:6933947-6933969 GTTTCTGTATTCAGCTGCCCAGG + Exonic
1096520621 12:52182668-52182690 GTTGAGGGAGACAGCTGGCCTGG + Intronic
1102031251 12:109741340-109741362 GAGGATGTAGGCAGCTGCCCTGG + Intronic
1102228009 12:111242786-111242808 GTTGATGGATGCAGCTGCCCCGG - Intronic
1102601913 12:114037704-114037726 GCTGGCGGCTGCAGCTGCCCTGG + Intergenic
1104357273 12:128098962-128098984 GGTGAAGGCAGCAGCTGCCCAGG - Intergenic
1104766055 12:131331047-131331069 ATGGATGGATGCTGCTGGCCTGG - Intergenic
1104843099 12:131834040-131834062 GCAGATGCAGGCAGCTGCCCAGG - Intronic
1108859213 13:54832928-54832950 CTTGCTGGATGGAGCTGTCCTGG + Intergenic
1118452200 14:65913280-65913302 GTTGATGGAAGGAGCTGCCCAGG + Intergenic
1119472158 14:74906979-74907001 GGTGACGGAAGCAGCTGGCCTGG - Exonic
1119900539 14:78255855-78255877 GTGGATGGATGCAGGTTCCCAGG + Intronic
1121554536 14:94826266-94826288 GTCGTTGGATGCAGATGTCCCGG - Intergenic
1122439764 14:101722605-101722627 GTCGTTGAATGCAGTTGCCCAGG + Intergenic
1122576481 14:102746201-102746223 GTAGATGACTGCAGCAGCCCTGG + Intergenic
1124492669 15:30167723-30167745 GGTGAAGGCTGCAGCTGTCCGGG + Intergenic
1124750865 15:32370602-32370624 GGTGAAGGCTGCAGCTGTCCGGG - Intergenic
1126860534 15:52878445-52878467 GTCGATGGATACGGCTTCCCTGG + Intergenic
1130966204 15:88699682-88699704 GAGGATGGATGCAAATGCCCAGG + Intergenic
1133117277 16:3584641-3584663 TCTGGTGGATGCAGCTGGCCTGG - Intronic
1133774432 16:8886093-8886115 CTTGAAGGAGGCAGCAGCCCCGG + Intergenic
1135937783 16:26795762-26795784 TTAGATGGATGCTGATGCCCAGG + Intergenic
1136696280 16:32084511-32084533 TATGCTGGCTGCAGCTGCCCAGG + Intergenic
1136796775 16:33027763-33027785 TATGCTGGCTGCAGCTGCCCAGG + Intergenic
1140966013 16:79966626-79966648 GATCATGGATGCTGCTGACCTGG - Intergenic
1141904708 16:87016723-87016745 GGTGGTGGAGGCAGCTGCGCTGG + Intergenic
1142164622 16:88579557-88579579 GTAGATGGGTCCAGCTGCTCTGG + Intronic
1142612249 17:1115493-1115515 GTTAGTGGCTGCAACTGCCCTGG - Intronic
1147476388 17:40715554-40715576 GGAGCTGGATGCATCTGCCCTGG + Intergenic
1151528202 17:74685950-74685972 GTTGATGGAGGCAAATCCCCAGG - Intronic
1151943896 17:77308942-77308964 GCTGAATCATGCAGCTGCCCAGG - Intronic
1152132157 17:78484235-78484257 GATTCTGGCTGCAGCTGCCCTGG + Intronic
1152276215 17:79359056-79359078 GTTGATGGATACACCTGGCCTGG - Intronic
1157582751 18:48782860-48782882 GTGGGTGGTGGCAGCTGCCCCGG - Intronic
1157662960 18:49461353-49461375 TTTGATGGAGGCAGCTGGCAGGG + Intergenic
1160978817 19:1807139-1807161 GCTGTTGGATGCAGCTGCCTGGG - Intronic
1161569096 19:5020467-5020489 GTTGAAGGGTGCAGCCGCCGTGG - Intronic
1162043573 19:7984741-7984763 GGTGAGGGATGAAGGTGCCCTGG + Intronic
1162131639 19:8529703-8529725 GTTGAGAGATGCATCTGGCCAGG + Intronic
1162141832 19:8589802-8589824 GTGGATGAATGCAGCATCCCGGG - Intronic
1163036804 19:14574413-14574435 GTTACTGGATGCAGCTGTGCAGG - Intergenic
1166095917 19:40539063-40539085 GTGGATGGATGCTTCAGCCCGGG - Intronic
925197386 2:1937252-1937274 AATGATGGCTGCAGCTGCTCTGG - Intronic
929978096 2:46654342-46654364 GATGATGGCTGCAGCAGCCTTGG + Intergenic
932705583 2:74021693-74021715 GGTTATGGATGCAGATTCCCAGG - Intronic
933897527 2:86825125-86825147 GGTGATGGGTGCATCTGCCTTGG + Intronic
945209181 2:207364632-207364654 GTCATTGGATGTAGCTGCCCAGG + Intergenic
946161106 2:217836578-217836600 GTTGGTTGATGCAGTTGCCTTGG - Intronic
946346095 2:219111724-219111746 GTTGTTTTCTGCAGCTGCCCTGG - Intronic
946978575 2:225180889-225180911 GGTGATGGATGCAGGAGCACAGG - Intergenic
947544271 2:231000322-231000344 GGTGAGGGAGGCACCTGCCCTGG - Intronic
1172025621 20:31946334-31946356 GTGGTTGGTTGTAGCTGCCCAGG - Intronic
1173837518 20:46135673-46135695 GTTGCTGGGTGCAGTTGCTCAGG - Intergenic
1174924985 20:54749648-54749670 GATGAGGGATGGAGCTGCACAGG + Intergenic
1175124914 20:56744164-56744186 GTTTATGGATGCAGAAACCCAGG + Intergenic
1175954027 20:62599132-62599154 CTTGATGAAGGCAGCTGGCCAGG - Intergenic
1176985469 21:15431189-15431211 ATCGCTGGATGCAGGTGCCCTGG + Intergenic
1179177677 21:39021020-39021042 GAAGAGGGAAGCAGCTGCCCTGG - Intergenic
1179505422 21:41836636-41836658 GATGATGGGTGAACCTGCCCAGG + Exonic
1180997042 22:19970850-19970872 GTGGATAGAAGCATCTGCCCTGG + Intronic
1183077116 22:35434166-35434188 CTTGATGGAGGCAGGAGCCCTGG + Intergenic
1183737065 22:39649991-39650013 GCAGATGGATGGGGCTGCCCAGG - Intronic
1184316647 22:43698425-43698447 GGTGATGGATACAGCATCCCGGG - Intronic
950223079 3:11211570-11211592 GCTGAGGCATGGAGCTGCCCTGG - Intronic
950313878 3:11983332-11983354 TTTGATATATGCACCTGCCCGGG - Intergenic
953916160 3:46922416-46922438 GTTGCTGGAGGGGGCTGCCCTGG + Intronic
955448957 3:59047015-59047037 ATTGTTGGCTGCAGCTGTCCTGG - Intronic
959572396 3:107899034-107899056 TTTGATGGAGGTAGCTGACCTGG - Intergenic
960082491 3:113556026-113556048 TTTGATGGATGAAGCTGCCCAGG + Intronic
961199525 3:125033261-125033283 GTTGAGGCTGGCAGCTGCCCTGG + Intronic
961787517 3:129356715-129356737 CTTGATGGATTCTGCTGCACTGG + Intergenic
961907541 3:130277886-130277908 ACTGATGGAGGCAGATGCCCTGG - Intergenic
961993778 3:131219451-131219473 GTTGATGGGTGCAGCAAACCTGG + Intronic
962595857 3:136942806-136942828 TTTAATGGATGCAGCAGCCTGGG - Intronic
965590934 3:170358812-170358834 GTTGAAGGATGGAGATTCCCAGG + Intronic
967025362 3:185559798-185559820 GTTGATGGGTGCAGCAAACCAGG + Intergenic
968642043 4:1719862-1719884 GTTTGAGGATGCAGCTGCCTGGG - Intronic
968974015 4:3811731-3811753 CTGGGTGGATGCAGCCGCCCAGG + Intergenic
969074911 4:4570313-4570335 GTGGAGGGATGCAGGTGACCAGG + Intergenic
969323425 4:6426747-6426769 GTGGATGGAGGCAGCTGAACTGG - Intronic
984817944 4:183855999-183856021 GCTGAAGGTGGCAGCTGCCCTGG + Intronic
985444555 4:190014990-190015012 GTAGAGGGAGACAGCTGCCCGGG + Intergenic
985869558 5:2543259-2543281 GGTGATTGATGGGGCTGCCCTGG + Intergenic
988426429 5:31070726-31070748 GGTGTTGGATGCAGCTAACCAGG - Intergenic
989216385 5:38908345-38908367 GTTCCTGCATGCAGTTGCCCTGG - Intronic
990282019 5:54261246-54261268 GTTAATGGGTGCAGCTGGCAAGG - Intronic
990937039 5:61162378-61162400 GTTGGTGGCTGCAGCTGCCGTGG - Exonic
992018646 5:72600453-72600475 GTTGTGTGATGCAGCAGCCCTGG - Intergenic
992173761 5:74129159-74129181 ATTAATGGATGCAGATGTCCAGG - Intergenic
992231736 5:74670713-74670735 GGTCATGGGTGCACCTGCCCGGG + Intronic
992388962 5:76312837-76312859 GGTGATGGCAGCAGCTGCCCAGG - Intronic
993315402 5:86398465-86398487 CTTGATGGATACAACTGGCCTGG - Intergenic
997605578 5:135173645-135173667 GTTGCTGGGTGCAGCTTCACTGG - Intronic
997626909 5:135337275-135337297 GTTGTTGGAGACAGCTGCCTGGG - Intronic
998368344 5:141645248-141645270 GTGGATGGGTGCACCTGCCTTGG - Intronic
999096815 5:148986529-148986551 GTTGATGGAGGTTGCTACCCTGG - Intronic
999702008 5:154236819-154236841 GTTGATGGATGGGGCTGCACAGG + Intronic
1000975980 5:167764827-167764849 TTTGATGGATGGAGCTGACTGGG + Intronic
1005288834 6:24358277-24358299 GTTCCTGGATGTAGTTGCCCAGG + Exonic
1006954381 6:37854467-37854489 GGTGATGGATCCAGGTCCCCAGG + Intronic
1006968310 6:38012769-38012791 GGTGATGGATGCATCAGCCTCGG + Intronic
1015936192 6:138407723-138407745 CTTGAAGGATGGAGCTGCCCAGG - Intronic
1019344991 7:525321-525343 GTTGGTGGCTGCAGCTGTCATGG + Intergenic
1020224320 7:6268076-6268098 GCTGATGCATGCAGATTCCCTGG - Intronic
1021598879 7:22344274-22344296 CTTGATGGATGGAGGAGCCCAGG - Intronic
1029026093 7:97418430-97418452 GTAGATGCATGCAGGTGCCAGGG + Intergenic
1031039235 7:116821580-116821602 GTTGATGGGTGCAGCAACCATGG - Intronic
1034725796 7:153333891-153333913 GTTGATGTTTGCTGCTGTCCTGG - Intergenic
1036386379 8:8285364-8285386 CTAGATGGACGCAGCTGACCTGG - Intergenic
1037449406 8:19001719-19001741 CTTGGTGGAGGCAGCAGCCCCGG + Intronic
1047344540 8:124014293-124014315 GATGAGGGATGAAGCTGCACAGG + Intronic
1049713896 8:144080499-144080521 GGTGTTGGAGGCTGCTGCCCAGG + Exonic
1050368459 9:4896162-4896184 GTTGATGGGTGCAGCAAACCAGG - Intergenic
1053727581 9:41019546-41019568 GTTGATGGATCCATTTGCACAGG - Intergenic
1053749599 9:41237683-41237705 GTAGAGGGAGACAGCTGCCCGGG - Intergenic
1054255045 9:62802564-62802586 GTAGAGGGAGACAGCTGCCCGGG - Intergenic
1054336263 9:63813042-63813064 GTAGAGGGAGACAGCTGCCCGGG + Intergenic
1054700933 9:68412561-68412583 GTTGATGGATCCATCTGCACAGG + Intronic
1055839720 9:80488674-80488696 GTCTATGGATGCAGATTCCCAGG - Intergenic
1056290330 9:85136643-85136665 GTGGATTGCTGCAGCTGCTCTGG - Intergenic
1056934711 9:90907341-90907363 GGTGATGGATGGAGGTGCACTGG - Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1060942052 9:127548372-127548394 GGTGATGGATGCAGCAGCTAAGG - Intronic
1061056489 9:128225475-128225497 GTTGCCGCATCCAGCTGCCCAGG - Intronic
1061432855 9:130542362-130542384 GGTGATGGATGCAAAAGCCCTGG - Intergenic
1186448375 X:9651888-9651910 GATAATGAATGCAGCTGCCCTGG - Intronic
1186511844 X:10135442-10135464 GTTGAAGAAGGCATCTGCCCTGG + Intronic
1186566669 X:10670526-10670548 GTTGTTGGGTGGAGCTGCCCTGG - Intronic
1187697905 X:21939936-21939958 GATGATGGAGGCATTTGCCCAGG + Intergenic
1195240977 X:102951451-102951473 CATTATGGACGCAGCTGCCCAGG + Intergenic
1195704514 X:107729307-107729329 GTTGATGGATTCTCCTTCCCTGG + Intronic
1195786151 X:108526168-108526190 GTTTATGGATGCACCTACCTTGG + Intronic
1196555915 X:117084193-117084215 GATGATGGATGCCCCTCCCCCGG + Intergenic
1201065848 Y:10093119-10093141 GTAGAGGGAGACAGCTGCCCTGG - Intergenic